Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20213

Mtmr10 myotubularin related protein 10 ( MGI:2142292)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20213 EMAGE:20213 EMAGE:20213 EMAGE:20213 EMAGE:20213
"Pseudo-wholemount" of euxassay_012297. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012297_01 euxassay_012297_02 euxassay_012297_03 euxassay_012297_04
EMAGE:20213 EMAGE:20213 EMAGE:20213 EMAGE:20213 EMAGE:20213
euxassay_012297_05 euxassay_012297_06 euxassay_012297_07 euxassay_012297_08 euxassay_012297_09
EMAGE:20213 EMAGE:20213 EMAGE:20213 EMAGE:20213 EMAGE:20213
euxassay_012297_10 euxassay_012297_11 euxassay_012297_12 euxassay_012297_13 euxassay_012297_14
EMAGE:20213 EMAGE:20213 EMAGE:20213 EMAGE:20213 EMAGE:20213
euxassay_012297_15 euxassay_012297_16 euxassay_012297_17 euxassay_012297_18 euxassay_012297_19
EMAGE:20213 EMAGE:20213 EMAGE:20213 EMAGE:20213
euxassay_012297_20 euxassay_012297_21 euxassay_012297_22 euxassay_012297_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20213Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20213_wholemount_strong.wlz
20213_wholemount_moderate.wlz
20213_wholemount_weak.wlz
20213_wholemount_possible.wlz
20213_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20213_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 04 05 06 07 08 21 22 23
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
olfactory cortex ventricular layer
weak weak
homogeneousweak expression: see section 10 11 15 16
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 weak expression: see section 09 10
pons ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 weak expression: see section 06 07 08 09 10 12 13 14 15 16 17 18
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 05 06 07 08 09 10 12 13 14 15 16 17
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 16 17 weak expression: see section 08 18
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30473
Entity Detected:Mtmr10, myotubularin related protein 10 ( MGI:2142292)
Sequence:sense strand is shown

>T30473
TCTCCAGACCAGCCAACCTACACGGCATTATCCTGCCACGTCTCTCCGGAACACACATAAAATTGTGGAA
ACTGTGCTACTTCCGTTGGGTCCCTGAGGCCCAGATCAACCTCGGGGGCTCCATCATGGCCTTCCACAAG
CTCTCTCTCCTGGCTGATGAGGTGGACATGCTGAGCAGGATGCTGAGGCAGCACCGCAGCGGCCCCTTGG
AAGCCTGCTATGCAGAGCTGGACCAGAGCAGGATGTACTTCCGGGCCACGGGGCCACATGACACGCTGGG
GACACCAGAGTTCCTCTCCTCTTCATTTCCATTTTCTCCTGTAGGAAATCTGTGTAGACGAAGCATTTTA
GGAACGCCATTAAGCAAATTTTTAAGTGGGGCCAAAATATGGTTATCTACTGAGACACTAGCAAATGAAG
ACTAAATTAAGGTATTTTTCTGGACATATTGAGAGAAGCTGGACATTTCCCTCTCTGAACTGAAATTGCT
AACTGAGGCATTTAAAACATTTTATATGTAAGAAATTTGCACAAATATTTAAACCATGTTTAATCATGCT
GCCTTCAGTTATTCTAAGGGCAGTGTGACTTTTGGGTTTGACCTTTGGGTCTGGCTCATTTGGGTCATTT
GCAGCACGAATTTCCCATTGTTACACTTGATATCAAAATATTGAGGTTCCTCTGCCATGCGAATTTTGCC
AACTTCTATTTTCCAACCTACTAAAGGTGATCTGATAGTCAGATTACAACCCAGAGAAAGTGGATAGGGA
AGTTAATAAATTAGTGTATTTAATGCATTTCTAGATCATCTGATAAAACTCCCAAGAGGCCTCAGTTGGC
ATCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30052208), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58884. Forward Primer - name:058884_F_IRAV107_d04_BB128963, sequence:TCTCCAGACCAGCCAACC; Reverse Primer - name:058884_R_SP6_IRAV107_d04_BB128963, sequence:GTGGATGCCAACTGAGGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20214 same embryo
 EMAGE:20216 same embryo
 EMAGE:20215 same embryo
 EMAGE:20217 same embryo
 EurExpress:euxassay_012297 same experiment
 MGI:4826495 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS