Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20278

Maged1 melanoma antigen, family D, 1 ( MGI:1930187)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20278 EMAGE:20278 EMAGE:20278 EMAGE:20278 EMAGE:20278
"Pseudo-wholemount" of euxassay_012384. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012384_01 euxassay_012384_02 euxassay_012384_03 euxassay_012384_04
EMAGE:20278 EMAGE:20278 EMAGE:20278 EMAGE:20278 EMAGE:20278
euxassay_012384_05 euxassay_012384_06 euxassay_012384_07 euxassay_012384_08 euxassay_012384_09
EMAGE:20278 EMAGE:20278 EMAGE:20278 EMAGE:20278 EMAGE:20278
euxassay_012384_10 euxassay_012384_11 euxassay_012384_12 euxassay_012384_13 euxassay_012384_14
EMAGE:20278 EMAGE:20278 EMAGE:20278 EMAGE:20278 EMAGE:20278
euxassay_012384_15 euxassay_012384_16 euxassay_012384_17 euxassay_012384_18 euxassay_012384_19
EMAGE:20278 EMAGE:20278 EMAGE:20278
euxassay_012384_20 euxassay_012384_21 euxassay_012384_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20278Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20278_wholemount_strong.wlz
20278_wholemount_moderate.wlz
20278_wholemount_weak.wlz
20278_wholemount_possible.wlz
20278_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20278_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
limb
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
gland
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
alimentary system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
nervous system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
integumental system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
sensory organ system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
cardiovascular system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
urinary system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
reproductive system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
respiratory system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
tail
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31284
Entity Detected:Maged1, melanoma antigen, family D, 1 ( MGI:1930187)
Sequence:sense strand is shown

>T31284
TCACAGAATGGCACCCCTAAAGGTCCACATGCTGCCTCTGACTTTTCCCAGGCAGCACCCACAGGCAAAT
CAGCTAAAAAGTCTGAAATGGCCTTTAAGGGTCAGAATAGCACTAAGGCTGGCCCCGGTACCACCTACAA
TTTCCCTCAGTCTCCCAGTGCCAATGAGATGACCAACAACCAGCCTAAGACAGCTAAGGCTTGGAATGAC
ACTACTAAGGTCCCTGGAGCTGATGCCCAGACCCAGAATGTAAATCAGGCCAAAATGGCTGACGTAGGGA
CCAGCGCAGGTATCTCTGAAGCTGATGGTGCAGCAGCCCAGACATCAGCAGATGGCTCCCAGACTCAGAA
CGTGGAGTCCCGGACTATAATTCGGGGCAAGAGGACCCGCAAGGTTAATAACTTGAATGTGGAAGAGAAC
AACAGTGGGGATCAAAGGCGTGCCTCACTGGCCTCAGGGAACTGGAGGTCTGCTCCGGTTCCAGTGACCA
CTCAGCAGAACCCACCTGGAGCACCCCCTAATGTGGTGTGGCAGACACCACTGGCTTGGCAGAACCCATC
AGGCTGGCAAAACCAGACAGCCAGGCAGACCCCACCAGCAGCACGTCAGAGTCCCCCAGCTAGGCAGACA
CCATCAGCTTGGCAGAACCCAGTTGCATGGCAGAATCCAGTGATCTGGCCTAACCCAGTGATCTGGCAGA
ATCCAGTGATCTGGCCAAACCCCATTGTCTGGCCTGGCCCAATTGTCTGGCCAAACCCAATGGCCTGGCA
GAGTACACCTGGATGGCAGAGCCCACCCAGCTGGCAGGCTCCACCTAGTTGGCAGAGCCCTCAAGATTGG
CAGGGCCCTCCAGATTGGCAGGTACCACCTGACTGGTCAATGCCTCCTGACTGGTCCTTTCCCTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4480947), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 54148. Forward Primer - name:054148_F_IRAV50_d05_Maged1, sequence:TCACAGAATGGCACCCCT; Reverse Primer - name:054148_R_SP6_IRAV50_d05_Maged1, sequence:CGGAGGGAAAGGACCAGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20280 same embryo
 EMAGE:20276 same embryo
 EMAGE:20277 same embryo
 EMAGE:20279 same embryo
 EurExpress:euxassay_012384 same experiment
 MGI:4826060 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS