Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20322

Eif2s1 eukaryotic translation initiation factor 2, subunit 1 alpha ( MGI:95299)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20322 EMAGE:20322 EMAGE:20322 EMAGE:20322 EMAGE:20322
"Pseudo-wholemount" of euxassay_012451. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012451_01 euxassay_012451_02 euxassay_012451_03 euxassay_012451_04
EMAGE:20322 EMAGE:20322 EMAGE:20322 EMAGE:20322 EMAGE:20322
euxassay_012451_05 euxassay_012451_06 euxassay_012451_07 euxassay_012451_08 euxassay_012451_09
EMAGE:20322 EMAGE:20322 EMAGE:20322 EMAGE:20322 EMAGE:20322
euxassay_012451_10 euxassay_012451_11 euxassay_012451_12 euxassay_012451_13 euxassay_012451_14
EMAGE:20322 EMAGE:20322 EMAGE:20322 EMAGE:20322 EMAGE:20322
euxassay_012451_15 euxassay_012451_16 euxassay_012451_17 euxassay_012451_18 euxassay_012451_19
EMAGE:20322 EMAGE:20322 EMAGE:20322 EMAGE:20322 EMAGE:20322
euxassay_012451_20 euxassay_012451_21 euxassay_012451_22 euxassay_012451_23 euxassay_012451_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20322Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20322_wholemount_strong.wlz
20322_wholemount_moderate.wlz
20322_wholemount_weak.wlz
20322_wholemount_possible.wlz
20322_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20322_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 17 18 19
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 19 20 21 22 23
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 13 15
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 13 15
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 12 16 17
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 16 17 weak expression: see section 13 18
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 16 17 18 19
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 13
mandible
moderate moderate
regionalmoderate expression: see section 03 04 05 06 21 22 23
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 17 weak expression: see section 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 10 18 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 17 weak expression: see section 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 10 18 19 20
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
renal cortex
weak weak
regionalweak expression: see section 08 09 10 11 17 18 19 20
lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 04 05 06 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31344
Entity Detected:Eif2s1, eukaryotic translation initiation factor 2, subunit 1 alpha ( MGI:95299)
Sequence:sense strand is shown

>T31344
GGGGGCCTATGTCAGCTTGTTGGAATATAATAACATTGAAGGCATGATTCTTCTTAGTGAATTATCCAGA
CGACGTATCCGTTCTATAAACAAACTGATCCGAATTGGCAGAAATGAATGTGTTGTTGTCATTAGAGTGG
ATAAAGAAAAAGGATATATAGATTTGTCAAAAAGAAGAGTTTCTCCAGAGGAAGCAATCAAATGTGAGGA
CAAATTCACAAAATCCAAAACTGTTTATAGCATTCTTCGCCATGTTGCTGAGGTATTAGAATATACCAAG
GATGAGCAGCTGGAGAGCCTGTTCCAGAGGACTGCCTGGGTCTTCGATGACAAGTACAAGAGACCTGGAT
ACGGTGCCTACGATGCTTTTAAGCATGCAGTCTCAGACCCATCTATCTTGGATAGTTTAGATTTGAATGA
AGATGAAAGAGAAGTACTCATTAATAATATCAATAGGCGTTTGACCCCACAAGCGGTCAAAATTCGAGCA
GATATTGAAGTAGCTTGCTATGGTTATGAAGGCATTGATGCTGTAAAAGAAGCCCTGAGGGCAGGTTTGA
ATTGTTCTACAGAAACCATGCCCATCAAGATTAATCTAATAGCTCCACCCAGGTATGTGATGACAACAAC
GACCCTGGAGAGGACAGAAGGCCTGTCTGTCCTCAATCAGGCTATGGCAGTTATCAAAGAGAAGATCGAG
GAGAAGAGGGGCGTCTTCAATGTTCAGATGGAGCCCAAAGTGGTCACAGATACAGATGAGACTGAACTTG
CAAGGCAGCTGGAACGGCTGGAGAGAGAAAATGCAGAAGTGGATGGAGATGATGATGCAGAAGAAATGGA
AGCCAAAGCTGAAGATTAACGTTTTGGCAAACAGTCCAATTTAAGGAGTACGAAGCAGCCCTTCCTGGCT
GTCAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4501321), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 35519. Forward Primer - name:035519_F_IRAV51-54_M11_Eif2s1, sequence:GGGGGCCTATGTCAGCTT; Reverse Primer - name:035519_R_SP6_IRAV51-54_M11_Eif2s1, sequence:GTTGACAGCCAGGAAGGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20321 same embryo
 EMAGE:20319 same embryo
 EMAGE:20320 same embryo
 EurExpress:euxassay_012451 same experiment
 MGI:4824505 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS