Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20361

Fam81a family with sequence similarity 81, member A ( MGI:1924136)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20361 EMAGE:20361 EMAGE:20361 EMAGE:20361 EMAGE:20361
"Pseudo-wholemount" of euxassay_012569. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012569_01 euxassay_012569_02 euxassay_012569_03 euxassay_012569_04
EMAGE:20361 EMAGE:20361 EMAGE:20361 EMAGE:20361 EMAGE:20361
euxassay_012569_05 euxassay_012569_06 euxassay_012569_07 euxassay_012569_08 euxassay_012569_09
EMAGE:20361 EMAGE:20361 EMAGE:20361 EMAGE:20361 EMAGE:20361
euxassay_012569_10 euxassay_012569_11 euxassay_012569_12 euxassay_012569_13 euxassay_012569_14
EMAGE:20361 EMAGE:20361 EMAGE:20361 EMAGE:20361 EMAGE:20361
euxassay_012569_15 euxassay_012569_16 euxassay_012569_17 euxassay_012569_18 euxassay_012569_19
EMAGE:20361 EMAGE:20361 EMAGE:20361 EMAGE:20361 EMAGE:20361
euxassay_012569_20 euxassay_012569_21 euxassay_012569_22 euxassay_012569_23 euxassay_012569_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20361Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20361_wholemount_strong.wlz
20361_wholemount_moderate.wlz
20361_wholemount_weak.wlz
20361_wholemount_possible.wlz
20361_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20361_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20 21 moderate expression: see section 03 04 05 06 12 13 14 15 16
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 21 22 23 24
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 13 14 15
choroid invagination
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 moderate expression: see section 12 16
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 09
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 19
pons mantle layer
weak weak
regionalweak expression: see section 07 08 17
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20 21 moderate expression: see section 03 04 05 06 12 13 14 15 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 09 10 18 19 20 21 22 weak expression: see section 04 05 06 07 08
anterior naris epithelium
weak weak
regionalweak expression: see section 11 12 13
external naris epithelium
weak weak
regionalweak expression: see section 12
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18
mandible
weak weak
regionalweak expression: see section 07 08 09 10 11 12 16 17 18 19
maxilla
weak weak
regionalweak expression: see section 07 08 09 10 11 12 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31546
Entity Detected:Fam81a, family with sequence similarity 81, member A ( MGI:1924136)
Sequence:sense strand is shown

>T31546
GGTGGAGCAGCTGGAAGACAGGATCCTCTGTCATGAGAAAACCACAGCAGCACTGGTGGAGCATGCCTTC
CGCATCAAAGATGACATCGTCAGCAGTTTGCAGAAGATGCAGAATAAAGGGGGAGGTGACCGCTTAGCCA
GGCTGTTCTTGGAAGAGCATATCAGAAACATAACCGCCATTGTGAAGCAACTGAATCGGGATATTGAGGT
TCTCCAGGAGCAGATCCGTGCCAGGGACAACATCAGCTATGGAACTAATTCTGCCTTAAAGACGCTGGAG
ATGCGCCAGCTCTCTGGCTTGGGAGATCTCCGAGGAAGAGTTGCAAGGTGCGACGCCAGCATAGCCAGGC
TCTCTGCCGAGCATAAGTCGACCTACGAGGGACTCCAGCACTTGAACAAGGAACAGCAAGCAGCCAAGCT
TATCCTGGAAACAAAAATCAAAGACGCAGAAGGACAGATTTCTCAGCTTTTGAGCAGAGTGGACTTGTCC
ATCTCAGAGCAGAGCACCAAACTGAAGATGTCCCACAGGGACAGCAACCACCAGCTCCAGCTCCTGGACA
CTAAATTTAAAGGCACCGTTGAAGAGCTCAGCAACCAGATTTTGTCTGCACGGAGTTGGCTGCAACAAGA
ACAGGAGCGGATAGAGAAAGAACTTCTGCAGAAAATAGACCATCTCTCCTTGATTGTTAAGGAAAACAGT
GGAGCCAATGAAAGAGACGTAGAGAAGAAACTCAGCCAGATGTCGGCCAGGCTTGACAAAATCGAAGAGA
GTCAGAAGAGGAATGCTGAAGGACAGAGAAAGCCGGACGAGGAGAAGGTGCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5324986), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 31441. Forward Primer - name:031441_F_IRAV67-70_L16_6430514L14Rik, sequence:GGTGGAGCAGCTGGAAGA; Reverse Primer - name:031441_R_SP6_IRAV67-70_L16_6430514L14Rik, sequence:CGTGCACCTTCTCCTCGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20359 same embryo
 EMAGE:20360 same embryo
 EMAGE:20358 same embryo
 EMAGE:20363 same embryo
 EMAGE:20362 same embryo
 EurExpress:euxassay_012569 same experiment
 MGI:4824760 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS