Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20407

Vps52 vacuolar protein sorting 52 (yeast) ( MGI:1330304)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20407 EMAGE:20407 EMAGE:20407 EMAGE:20407 EMAGE:20407
"Pseudo-wholemount" of euxassay_012681. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012681_01 euxassay_012681_02 euxassay_012681_03 euxassay_012681_04
EMAGE:20407 EMAGE:20407 EMAGE:20407 EMAGE:20407 EMAGE:20407
euxassay_012681_05 euxassay_012681_06 euxassay_012681_07 euxassay_012681_08 euxassay_012681_09
EMAGE:20407 EMAGE:20407 EMAGE:20407 EMAGE:20407 EMAGE:20407
euxassay_012681_10 euxassay_012681_11 euxassay_012681_12 euxassay_012681_13 euxassay_012681_14
EMAGE:20407 EMAGE:20407 EMAGE:20407 EMAGE:20407 EMAGE:20407
euxassay_012681_15 euxassay_012681_16 euxassay_012681_17 euxassay_012681_18 euxassay_012681_19
EMAGE:20407 EMAGE:20407 EMAGE:20407 EMAGE:20407 EMAGE:20407
euxassay_012681_20 euxassay_012681_21 euxassay_012681_22 euxassay_012681_23 euxassay_012681_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20407Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20407_wholemount_strong.wlz
20407_wholemount_moderate.wlz
20407_wholemount_weak.wlz
20407_wholemount_possible.wlz
20407_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20407_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31949
Entity Detected:Vps52, vacuolar protein sorting 52 (yeast) ( MGI:1330304)
Sequence:sense strand is shown

>T31949
AGCTGCAGGAGCTGGATGCCAAGGCAGCCGCGGTGAGAGAGCAGGAGGCTATGGGCACCGCTGCCTGTGC
TGACGTCAGAGGAGTGCTGGACCGGCTCCGGGTCAAGGCAGTGACGAAGATCCGGGAGTTCATTCTCCAG
AAGATCTACTCCTTCAGAAAGCCCATGACCAACTACCAGATCCCCCAGGCGGCCCTGCTGAAGTACAGGT
TTTTCTATCAGTTCCTGCTGGGCAATGAGCGTGCTACAGCCAAAGAGATCAGGGATGAGTACGTAGAGAC
GCTGAGCAAGATCTACCTGTCCTACTACCGATCCTATGTGGGGCGGCTCATGAAAGTGCAGTACGAGGAA
GTTGCTGAGAAAGACGACCTAATGGGTGTTGAAGACACAGCAAAGAAAGGCTTCTTCTCGAAGCCGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30251096), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61333. Forward Primer - name:061333_F_IRAW6_g12_Vps52, sequence:AGCTGCAGGAGCTGGATG; Reverse Primer - name:061333_R_SP6_IRAW6_g12_Vps52, sequence:GGACGGCTTCGAGAAGAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20406 same embryo
 EMAGE:20410 same embryo
 EMAGE:20409 same embryo
 EMAGE:20411 same embryo
 EMAGE:20408 same embryo
 EurExpress:euxassay_012681 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS