Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20419

Txnl4a thioredoxin-like 4A ( MGI:1351613)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20419 EMAGE:20419 EMAGE:20419 EMAGE:20419 EMAGE:20419
"Pseudo-wholemount" of euxassay_012641. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012641_01 euxassay_012641_02 euxassay_012641_03 euxassay_012641_04
EMAGE:20419 EMAGE:20419 EMAGE:20419 EMAGE:20419 EMAGE:20419
euxassay_012641_05 euxassay_012641_06 euxassay_012641_07 euxassay_012641_08 euxassay_012641_09
EMAGE:20419 EMAGE:20419 EMAGE:20419 EMAGE:20419 EMAGE:20419
euxassay_012641_10 euxassay_012641_11 euxassay_012641_12 euxassay_012641_13 euxassay_012641_14
EMAGE:20419 EMAGE:20419 EMAGE:20419 EMAGE:20419 EMAGE:20419
euxassay_012641_15 euxassay_012641_16 euxassay_012641_17 euxassay_012641_18 euxassay_012641_19
EMAGE:20419 EMAGE:20419 EMAGE:20419
euxassay_012641_20 euxassay_012641_21 euxassay_012641_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20419Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20419_wholemount_strong.wlz
20419_wholemount_moderate.wlz
20419_wholemount_weak.wlz
20419_wholemount_possible.wlz
20419_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20419_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 10 16 17 18 19
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 03 04 10 11 13 14 16 17 18 weak expression: see section 05 06 07 08 09 15 19 20 22
midbrain ventricular layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 07 17
upper jaw incisor
weak weak
regionalweak expression: see section 11 14 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 06 07 17
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
renal cortex
weak weak
regionalweak expression: see section 05 06 07 08 09 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31603
Entity Detected:Txnl4a, thioredoxin-like 4A ( MGI:1351613)
Sequence:sense strand is shown

>T31603
GTCGTACATGCTTCCGCATCTGCACAATGGCTGGCAGGTAGACCAGGCCATCCTTTCGGAGGAGGACCGC
GTGGTCGTCATTCGTTTCGGACACGACTGGGACCCCACTTGCATGAAGATGGACGAGGTTCTGTACAGCA
TCGCCGAAAAGGTTAAAAATTTTGCAGTTATTTATCTTGTGGATATTACAGAAGTGCCTGACTTCAACAA
GATGTACGAGCTGTATGACCCCTGCACTGTCATGTTCTTCTTCAGAAACAAACATATCATGATTGATTTG
GGCACTGGCAACAACAACAAGATCAACTGGGCCATGGAAGACAAGCAAGAAATGGTTGACATCATAGAGA
CCGTGTACCGTGGCGCCCGCAAAGGCCGGGGTCTGGTGGTGTCTCCCAAGGACTATTCTACCAAGTACAG
ATACTGAGCCCTGCCCTCAGGCTGTGCAAAGGACACTGAGAGCCTCTTCCACATAGAAATCCTCTGCTCT
CGTAGCCTCTGGAAAGGCCCTGCAGCCCGACATTGCTGTAGAGCTGGAGGATCCGTGAGATGAGGGTTAC
AGAGCCTTAGCTAGCTGAAGCAAATAAACATGGCGAGGGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3662554), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 27810. Forward Primer - name:027810_F_IRAV77-80_G08_Txnl4, sequence:GTCGTACATGCTTCCGCA; Reverse Primer - name:027810_R_SP6_IRAV77-80_G08_Txnl4, sequence:GCTCCCTCGCCATGTTTA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20416 same embryo
 EMAGE:20420 same embryo
 EMAGE:20417 same embryo
 EMAGE:20415 same embryo
 EMAGE:20418 same embryo
 EurExpress:euxassay_012641 same experiment
 MGI:4829034 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS