Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20424

Cd1d1 CD1d1 antigen ( MGI:107674)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20424 EMAGE:20424 EMAGE:20424 EMAGE:20424 EMAGE:20424
"Pseudo-wholemount" of euxassay_012661. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012661_01 euxassay_012661_02 euxassay_012661_03 euxassay_012661_04
EMAGE:20424 EMAGE:20424 EMAGE:20424 EMAGE:20424 EMAGE:20424
euxassay_012661_05 euxassay_012661_06 euxassay_012661_07 euxassay_012661_08 euxassay_012661_09
EMAGE:20424 EMAGE:20424 EMAGE:20424 EMAGE:20424 EMAGE:20424
euxassay_012661_10 euxassay_012661_11 euxassay_012661_12 euxassay_012661_13 euxassay_012661_14
EMAGE:20424 EMAGE:20424 EMAGE:20424 EMAGE:20424 EMAGE:20424
euxassay_012661_15 euxassay_012661_16 euxassay_012661_17 euxassay_012661_18 euxassay_012661_19
EMAGE:20424 EMAGE:20424 EMAGE:20424
euxassay_012661_20 euxassay_012661_21 euxassay_012661_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20424Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20424_wholemount_strong.wlz
20424_wholemount_moderate.wlz
20424_wholemount_weak.wlz
20424_wholemount_possible.wlz
20424_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20424_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
weak weak
regionalweak expression: see section 09 10 11 13
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 08 09 13
telencephalon mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13
mandible
moderate moderate
regionalmoderate expression: see section 04 06 17 18 weak expression: see section 03 05 15 16 19
maxilla
moderate moderate
regionalmoderate expression: see section 04 18 weak expression: see section 06 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32145
Entity Detected:Cd1d1, CD1d1 antigen ( MGI:107674)
Sequence:sense strand is shown

>T32145
CCTTACACCTGCCTCTCCTGAAATTCAGACTTTCCAGGCTCTAGGACTTCAGTCCTGGTCTGCTCAGGAT
CTGGGGATGAAGGAGAGGAATCCTGAAGAAGTGAAGAGCAGCCAGTACGCTCTTTTCAACATTAATTATA
AGAAATTAATTATTTGAGTTGTTTCGTCAGTTTCCATAGTTTAGAACAAACACAACTGCAAATGTGCGTA
CCTGCCAGAAACAAGCTGTTGGCAGTGTTTTATGGGATTTGCACTGAACTAGAAAGCATACTTCCTGCCC
AAACAGACGCTCTGAGGTTAGTTGGCAAGTGTAAAGTCCAACACCAACCTGGCTGTACTCTGTATTTTTC
AAGGTGACTAGAAAAATGGATTTGTGTGTGTGTGACATACAGCTTTGGGGTTTGTTGGCAAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4917095), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60290. Forward Primer - name:060290_F_IRAV96_a04_Cd1d1, sequence:CCTTACACCTGCCTCTCCTG; Reverse Primer - name:060290_R_SP6_IRAV96_a04_Cd1d1, sequence:CACTTGCCAACAAACCCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20422 same embryo
 EMAGE:20425 same embryo
 EMAGE:20421 same embryo
 EMAGE:20423 same embryo
 EurExpress:euxassay_012661 same experiment
 MGI:4823717 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS