Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20477

Foxc1 forkhead box C1 ( MGI:1347466)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20477 EMAGE:20477 EMAGE:20477 EMAGE:20477 EMAGE:20477
"Pseudo-wholemount" of euxassay_012742. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012742_01 euxassay_012742_02 euxassay_012742_03 euxassay_012742_04
EMAGE:20477 EMAGE:20477 EMAGE:20477 EMAGE:20477 EMAGE:20477
euxassay_012742_05 euxassay_012742_06 euxassay_012742_07 euxassay_012742_08 euxassay_012742_09
EMAGE:20477 EMAGE:20477 EMAGE:20477 EMAGE:20477 EMAGE:20477
euxassay_012742_10 euxassay_012742_11 euxassay_012742_12 euxassay_012742_13 euxassay_012742_14
EMAGE:20477 EMAGE:20477 EMAGE:20477 EMAGE:20477 EMAGE:20477
euxassay_012742_15 euxassay_012742_16 euxassay_012742_17 euxassay_012742_18 euxassay_012742_19
EMAGE:20477 EMAGE:20477 EMAGE:20477 EMAGE:20477
euxassay_012742_20 euxassay_012742_21 euxassay_012742_22 euxassay_012742_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20477Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20477_wholemount_strong.wlz
20477_wholemount_moderate.wlz
20477_wholemount_weak.wlz
20477_wholemount_possible.wlz
20477_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20477_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 weak expression: see section 22 23
forelimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 weak expression: see section 22 23
forelimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 23
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 20 weak expression: see section 21 22
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 20 weak expression: see section 21 22
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 20 weak expression: see section 21 22
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 20 weak expression: see section 21 22
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 20 weak expression: see section 21 22
lower leg mesenchyme
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 23
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 17 18 19
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 01 02
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midbrain meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19
otic capsule
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 18 19 20 21 22
nasal cavity
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 14 15 16 17
nasal septum
moderate moderate
regionalmoderate expression: see section 12 13
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38224
Entity Detected:Foxc1, forkhead box C1 ( MGI:1347466)
Sequence:sense strand is shown

>T38224
CACGTAAGTTTCTTGCGTTCAGAGACTCGCTTTCCTGCTCATTCGTCTTGCCCCTCTGCCTCTGCCTTGC
CTCTCACCTGTAAGATATTTTATCCTATGTCGAAAGAACGGGAAAGTACCTGTTTATGAAAATCGCTTTC
TTTTTATTCATGGACTTGTTTTTAAATGTAAATTGCAACATAGTAATTTATTTTTAATTTGTAGTTGGAT
GTTACGGACCAAACACCAGAAAGTGTTCCAAAAGCTTTTCAAGTTAAATTGCCTGAAACTTTTAAAATGT
GCCTTTTCTCTCATTATAAAAAGGGAAACTGTATTAATCTCCTTCTATCATCCTTTTCTTTTTGTTGATC
ATATCCATTGTTTGTTTATTAATAAATTGCCATTCAGTTTGAATAAGACCTATATGTCTGAATACTTTAA
TACAGCTTTAATAGAAAAGATTTCAGAGCGGAAATTGTAGGAGTTCCCTAGTCTCTGTCAGATTTTTTAA
ATGTGGAGAAAACTTCTAGGTGATGTCAAATTTCGCTAAACTCAGTTTTTAAAATTGTTAAGTAGATTTT
TTTTCCCCCTACAGCGTTTTCTGCAAAACATACTATCTAGTCAACTTGCTTTGTGGCTATTAAAAGGATA
ATTTCCTAAGTAGATCTGAGTTGGCACATGAACAAATACTTTTCTTCAGTAACTACAGAACATGATTTGG
CG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 146830. Forward Primer - name:146830_F_cDNA_Foxc1, sequence:CACGTAAGTTTCTTGCGTTCAG; Reverse Primer - name:146830_N_SP6_cDNA_Foxc1, sequence:CGCCAAATCATGTTCTGTAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20478 same embryo
 EMAGE:20481 same embryo
 EMAGE:20479 same embryo
 EMAGE:20480 same embryo
 EMAGE:20476 same embryo
 EurExpress:euxassay_012742 same experiment
 MGI:4824898 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS