Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20574

Bcor BCL6 interacting corepressor ( MGI:1918708)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20574 EMAGE:20574 EMAGE:20574 EMAGE:20574 EMAGE:20574
"Pseudo-wholemount" of euxassay_013800. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013800_01 euxassay_013800_02 euxassay_013800_03 euxassay_013800_04
EMAGE:20574 EMAGE:20574 EMAGE:20574 EMAGE:20574 EMAGE:20574
euxassay_013800_05 euxassay_013800_06 euxassay_013800_07 euxassay_013800_08 euxassay_013800_09
EMAGE:20574 EMAGE:20574 EMAGE:20574 EMAGE:20574 EMAGE:20574
euxassay_013800_10 euxassay_013800_11 euxassay_013800_12 euxassay_013800_13 euxassay_013800_14
EMAGE:20574 EMAGE:20574 EMAGE:20574 EMAGE:20574 EMAGE:20574
euxassay_013800_15 euxassay_013800_16 euxassay_013800_17 euxassay_013800_18 euxassay_013800_19
EMAGE:20574 EMAGE:20574 EMAGE:20574 EMAGE:20574
euxassay_013800_20 euxassay_013800_21 euxassay_013800_22 euxassay_013800_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20574Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20574_wholemount_strong.wlz
20574_wholemount_moderate.wlz
20574_wholemount_weak.wlz
20574_wholemount_possible.wlz
20574_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20574_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13 14
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13 14
cerebral cortex ventricular layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 15 16 18 19
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 13 14 15 16 17 weak expression: see section 08 09 10 11 12
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 15 16 17
lower jaw molar
weak weak
regionalweak expression: see section 07 19
upper jaw incisor
weak weak
regionalweak expression: see section 15 17
upper jaw molar
weak weak
regionalweak expression: see section 07 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38105
Entity Detected:Bcor, BCL6 interacting corepressor ( MGI:1918708)
Sequence:sense strand is shown

>T38105
GCAGAGACATACTCCGAGTTCCACAAGCACTATCCCAGGATCTCCACCTCTCCCTCAGTCACCCTGACGA
AGCCATACATGACAGCCAATAGCGAGTTCTCTACATCCAGGCTGTCCAATGGCAAGTACCCCAAGGCTCT
AGATGGGGGCGACTGTGCTCAATCCATGCCTGGGCACACCCGGAAGACAACGGTTCAAGACAGAAAAGAT
GGGGGCTCACCACCTCTGTTGGAAAAGCAGACCGTTACCAAAGATGTCACAGACAAACCACTTGACCTGT
CTTCTAAAGTGGTGGATGCGGACGCTTCCAAAGGTGACCACATGAAAAAGATGGCTCCCACAGTCCTGGT
TCACAGTCGGGCTGCAAGTGGCTTAGTGCTCTCTGGAAGTGAGATTCCGAAAGAAACACTATCTCCTCCA
GGAAATGGATGTTCTATCTATAGATCAGAGATCATCAGCACTGCTCCCTCATCCTGGGTGGTGCCAGGGC
CAAGTCCTAATGAAGAGAACAATGGCAAAAGTCTGTCACTGAAAAACAAGGCTTTGGACTGGGCAATACC
GCAACAGCGGAGTTCCTCGTGTCCCCGCATGGGTGGCACAGATGCCGTGGTCACTAATGTTTCAGGGTCC
GTGTCCAGCTCAGGACGCCCAGCCTCTGCATCACCAGCCCCCAACGCCAACGCCAATGCAGATGGCACCA
AGACCAGCAGGAGCTCGGTGGATACCACGCCATCAGTCATCCAGCATGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 104232. Forward Primer - name:104232_F_cDNA_Bcor, sequence:GCAGAGACATACTCCGAGTTCC; Reverse Primer - name:104232_N_SP6_cDNA_Bcor, sequence:CCACATGCTGGATGACTGATG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20573 same embryo
 EMAGE:20572 same embryo
 EMAGE:20576 same embryo
 EMAGE:20575 same embryo
 EMAGE:20571 same embryo
 EurExpress:euxassay_013800 same experiment
 MGI:4823455 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS