Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20578

Ccdc109a coiled-coil domain containing 109A ( MGI:3026965)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20578 EMAGE:20578 EMAGE:20578 EMAGE:20578 EMAGE:20578
"Pseudo-wholemount" of euxassay_014085. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014085_01 euxassay_014085_02 euxassay_014085_03 euxassay_014085_04
EMAGE:20578 EMAGE:20578 EMAGE:20578 EMAGE:20578 EMAGE:20578
euxassay_014085_05 euxassay_014085_06 euxassay_014085_07 euxassay_014085_08 euxassay_014085_09
EMAGE:20578 EMAGE:20578 EMAGE:20578 EMAGE:20578 EMAGE:20578
euxassay_014085_10 euxassay_014085_11 euxassay_014085_12 euxassay_014085_13 euxassay_014085_14
EMAGE:20578 EMAGE:20578 EMAGE:20578 EMAGE:20578 EMAGE:20578
euxassay_014085_15 euxassay_014085_16 euxassay_014085_17 euxassay_014085_18 euxassay_014085_19
EMAGE:20578 EMAGE:20578 EMAGE:20578 EMAGE:20578 EMAGE:20578
euxassay_014085_20 euxassay_014085_21 euxassay_014085_22 euxassay_014085_23 euxassay_014085_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20578Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20578_wholemount_strong.wlz
20578_wholemount_moderate.wlz
20578_wholemount_weak.wlz
20578_wholemount_possible.wlz
20578_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20578_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22 23 24
upper leg muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 19 20
diaphragm
weak weak
regionalweak expression: see section 02 03 04 05 06 16 17 18 19 20 21
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 03 20
lower leg mesenchyme
moderate moderate
regionalmoderate expression: see section 21 23 24
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 09 10 13 14 15
metencephalon floor plate
weak weak
regionalweak expression: see section 12
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
tongue mesenchyme
moderate moderate
regionalmoderate expression: see section 10
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 09 13 14
hindgut
weak weak
regionalweak expression: see section 10 11
midgut
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39482
Entity Detected:Ccdc109a, coiled-coil domain containing 109A ( MGI:3026965)
Sequence:sense strand is shown

>T39482
CAAAGAGAGACCTCCTAAGCCATGAAGATGCAGCGACGCTGAACGACGTGAAGACCCTGGTCCAGCAGCT
GTACACCACACTGTGCATTGAGCAGCATCAGCTTAACAAAGAGCGGGAGCTCGTGGAGAGGTTAGAGGAC
CTCAAGCAGCAGCTGGCCCCCCTGGAGAAGGTACGAATTGAAATTAGCAGAAAAGCAGAGAAGAGGACCA
CTCTGGTGCTGTGGGGAGGCCTGGCCTACATGGCCACCCAGTTTGGCATTCTGGCCCGGCTCACCTGGTG
GGAGTACTCGTGGGACATCATGGAGCCCGTCACCTACTTCATCACGTACGGAAGCGCCATGGCCATGTAT
GCGTATTTTGTAATGACGCGCCAGGAATATGTTTATCCAGAAGCCAGAGACAGACAATACTTATTATTTT
TCCATAAAGGAGCCAAAAAGTCACGTTTCGACCTAGAGAAATACAATCAGCTCAAGGATGCAATTGCTCA
GGCAGAAATGGATCTTAAGAGACTGAGAGACCCATTACAAGTACACCTGCCCCTCCGACAGATCGGAGAA
AAGGAATGATCCGAGATGACCGTGAATCCCGGCAGAGAGTGCGCCTGTTTGTAACTCACGCCGTTTTAAT
TAAAGCATGGCAGGTGGAGGCTGGGGTAGAGGGTTTTTACCTTTAATTCTAAAAACAAAACACAAAAAGG
ATCTTAGGGAATAAAGGGATCTTAAATGCTGAGGATCCAGCATCATGGAATCCAAGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82626. Forward Primer - name:082626_F_cDNA_D130073L02Rik, sequence:CAAAGAGAGACCTCCTAAGCCA; Reverse Primer - name:082626_N_SP6_cDNA_D130073L02Rik, sequence:CACTTGGATTCCATGATGCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20582 same embryo
 EMAGE:20579 same embryo
 EMAGE:20581 same embryo
 EMAGE:20577 same embryo
 EMAGE:20580 same embryo
 EurExpress:euxassay_014085 same experiment
 MGI:4823663 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS