Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20688

Olfr1019 olfactory receptor 1019 ( MGI:3030853)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20688 EMAGE:20688 EMAGE:20688 EMAGE:20688 EMAGE:20688
"Pseudo-wholemount" of euxassay_013878. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013878_01 euxassay_013878_02 euxassay_013878_03 euxassay_013878_04
EMAGE:20688 EMAGE:20688 EMAGE:20688 EMAGE:20688 EMAGE:20688
euxassay_013878_05 euxassay_013878_06 euxassay_013878_07 euxassay_013878_08 euxassay_013878_09
EMAGE:20688 EMAGE:20688 EMAGE:20688 EMAGE:20688 EMAGE:20688
euxassay_013878_10 euxassay_013878_11 euxassay_013878_12 euxassay_013878_13 euxassay_013878_14
EMAGE:20688 EMAGE:20688 EMAGE:20688 EMAGE:20688 EMAGE:20688
euxassay_013878_15 euxassay_013878_16 euxassay_013878_17 euxassay_013878_18 euxassay_013878_19
EMAGE:20688 EMAGE:20688 EMAGE:20688 EMAGE:20688 EMAGE:20688
euxassay_013878_20 euxassay_013878_21 euxassay_013878_22 euxassay_013878_23 euxassay_013878_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20688Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20688_wholemount_strong.wlz
20688_wholemount_moderate.wlz
20688_wholemount_weak.wlz
20688_wholemount_possible.wlz
20688_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20688_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39156
Entity Detected:Olfr1019, olfactory receptor 1019 ( MGI:3030853)
Sequence:sense strand is shown

>T39156
TTCGCTGGCCTAGTGAGTTTAGTGGCGCATACTTCTCTCACTTTCAGCCTCAGTTACTGTGGTTCCAATA
TCATCAACCATTTCTTCTGTGAAATCCCACCACTCTTAGCTCTCTCTTGCTCAGATACCTACATTAGTGA
GATACTGCTGTTTAGTTTGTGTGGCTTCATTGAGTTCAGCACCATCCTTATCATCTTCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 278739. Forward Primer - name:278739_F_cDNA_Olfr1019, sequence:TTCGCTGGCCTAGTGAGTTT; Reverse Primer - name:278739_N_SP6_cDNA_Olfr1019, sequence:TGAAGATGATAAGGATGGTGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20692 same embryo
 EMAGE:20691 same embryo
 EMAGE:20690 same embryo
 EMAGE:20687 same embryo
 EMAGE:20689 same embryo
 EurExpress:euxassay_013878 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS