Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20735

Mela melanoma antigen ( MGI:107565)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20735 EMAGE:20735 EMAGE:20735 EMAGE:20735 EMAGE:20735
"Pseudo-wholemount" of euxassay_013975. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013975_01 euxassay_013975_02 euxassay_013975_03 euxassay_013975_04
EMAGE:20735 EMAGE:20735 EMAGE:20735 EMAGE:20735 EMAGE:20735
euxassay_013975_05 euxassay_013975_06 euxassay_013975_07 euxassay_013975_08 euxassay_013975_09
EMAGE:20735 EMAGE:20735 EMAGE:20735 EMAGE:20735 EMAGE:20735
euxassay_013975_10 euxassay_013975_11 euxassay_013975_12 euxassay_013975_13 euxassay_013975_14
EMAGE:20735 EMAGE:20735 EMAGE:20735 EMAGE:20735 EMAGE:20735
euxassay_013975_15 euxassay_013975_16 euxassay_013975_17 euxassay_013975_18 euxassay_013975_19
EMAGE:20735 EMAGE:20735 EMAGE:20735
euxassay_013975_20 euxassay_013975_21 euxassay_013975_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20735Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20735_wholemount_strong.wlz
20735_wholemount_moderate.wlz
20735_wholemount_weak.wlz
20735_wholemount_possible.wlz
20735_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20735_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 08 09 10 11
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 08 09 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 01 02 03 04 05 06 07
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 07 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39417
Entity Detected:Mela, melanoma antigen ( MGI:107565)
Sequence:sense strand is shown

>T39417
AGCTAACTGCAGTAACGCCATTTTGCAAGGCATGGGAAAATACCAGAGCTGATGTTCTCAGAAAAACAAG
AACAAGGAAGTACAGAGAGGCTGGAAAGTACCGGGACTAGGGCCAAACAGGATATCTGTGGTCAAGCACT
AGGGCCCCGGCCCAGGGCCAAGAACAGATGGTCCCCAGAAATAGCTAAAACAACAACAGTTTCAAGAGAC
CCAGAAACTGTCTCAAGGTTCCCCAGATGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98099. Forward Primer - name:098099_F_cDNA_Mela, sequence:AGCTAACTGCAGTAACGCCATT; Reverse Primer - name:098099_N_SP6_cDNA_Mela, sequence:GTCATCTGGGGAACCTTGAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20737 same embryo
 EMAGE:20736 same embryo
 EMAGE:20738 same embryo
 EMAGE:20734 same embryo
 EMAGE:20733 same embryo
 EurExpress:euxassay_013975 same experiment
 MGI:4826158 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS