Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21005

Olfr1339 olfactory receptor 1339 ( MGI:3031173)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21005 EMAGE:21005 EMAGE:21005 EMAGE:21005 EMAGE:21005
"Pseudo-wholemount" of euxassay_012990. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012990_01 euxassay_012990_02 euxassay_012990_03 euxassay_012990_04
EMAGE:21005 EMAGE:21005 EMAGE:21005 EMAGE:21005 EMAGE:21005
euxassay_012990_05 euxassay_012990_06 euxassay_012990_07 euxassay_012990_08 euxassay_012990_09
EMAGE:21005 EMAGE:21005 EMAGE:21005 EMAGE:21005 EMAGE:21005
euxassay_012990_10 euxassay_012990_11 euxassay_012990_12 euxassay_012990_13 euxassay_012990_14
EMAGE:21005 EMAGE:21005 EMAGE:21005 EMAGE:21005 EMAGE:21005
euxassay_012990_15 euxassay_012990_16 euxassay_012990_17 euxassay_012990_18 euxassay_012990_19
EMAGE:21005 EMAGE:21005 EMAGE:21005 EMAGE:21005 EMAGE:21005
euxassay_012990_20 euxassay_012990_21 euxassay_012990_22 euxassay_012990_23 euxassay_012990_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21005Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21005_wholemount_strong.wlz
21005_wholemount_moderate.wlz
21005_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21005_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
moderate moderate
spottedmoderate expression: see section 2 5
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39098
Entity Detected:Olfr1339, olfactory receptor 1339 ( MGI:3031173)
Sequence:sense strand is shown

>T39098
ACTATGGGGTGTCAGCTGTTCTCTGATCTACACTGTTTTCACTATGAGGCTGCCCTACTGTGGCCCCAAT
GAGATCAATCACTTCTTCTGTGAGGTCCCTGCTGTTCTGAAGCTTGCCTGTGCAGACACATCCCTCAATG
ACCGGATAGACTTTATCCTAGGCTTTATCCTTCTCCTGGTACCTCTTTCCTTCATCCTGGCCTCTTACGT
CTGCATCTTTGCCACCATTCTGAGAATCCGCTCAGCCCAAGGTCGACTGAAGGCCTTTTCCACCTGTGCC
TCTCACATCACTGTGGTCACCATGTTCTGTGGACCTGCCATGTTTATGTACATGAACCCTGGGGCCAACG
CCTCCCCAGAGAGGGACAAGAAACTGGCTCTGTTCTACAATGTCATCTCTGCTTTCCTCAACCCTATAAT
C
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 152487. Forward Primer - name:152487_F_cDNA_Olfr1339, sequence:ACTATGGGGTGTCAGCTGTTCT; Reverse Primer - name:152487_N_SP6_cDNA_Olfr1339, sequence:GATTATAGGGTTGAGGAAAGCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012990 same experiment
 EMAGE:21001 same embryo
 EMAGE:21003 same embryo
 EMAGE:21002 same embryo
 EMAGE:21004 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS