Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21315

Glb1l2 galactosidase, beta 1-like 2 ( MGI:2388283)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21315 EMAGE:21315 EMAGE:21315 EMAGE:21315 EMAGE:21315
euxassay_008223_01 euxassay_008223_02 euxassay_008223_03 euxassay_008223_04 euxassay_008223_05
EMAGE:21315 EMAGE:21315 EMAGE:21315 EMAGE:21315 EMAGE:21315
euxassay_008223_06 euxassay_008223_07 euxassay_008223_08 euxassay_008223_09 euxassay_008223_10
EMAGE:21315 EMAGE:21315 EMAGE:21315 EMAGE:21315 EMAGE:21315
euxassay_008223_11 euxassay_008223_12 euxassay_008223_13 euxassay_008223_14 euxassay_008223_15
EMAGE:21315 EMAGE:21315 EMAGE:21315 EMAGE:21315 EMAGE:21315
euxassay_008223_16 euxassay_008223_17 euxassay_008223_18 euxassay_008223_19 euxassay_008223_20
EMAGE:21315 EMAGE:21315 EMAGE:21315
euxassay_008223_21 euxassay_008223_22 euxassay_008223_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21315Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21315_wholemount_strong.wlz
21315_wholemount_moderate.wlz
21315_wholemount_weak.wlz
21315_wholemount_possible.wlz
21315_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21315_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 5 6 7 8 7 8 9
anterior naris
strong strong
regionalstrong expression: see section 1
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 9 0 1 2 4 5 6 7 8 9
lower jaw molar
strong strong
regionalstrong expression: see section 7 9
upper jaw molar
strong strong
regionalstrong expression: see section 9
bladder
strong strong
regionalstrong expression: see section 2 3 4 5 moderate expression: see section 6
kidney calyx
strong strong
regionalstrong expression: see section 8 9 0 1 7 8 9 0 1 2
kidney pelvis
strong strong
regionalstrong expression: see section 9 9
ureter
strong strong
regionalstrong expression: see section 2
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1625
Entity Detected:Glb1l2, galactosidase, beta 1-like 2 ( MGI:2388283)
Sequence:sense strand is shown

>T1625
TGGCCTCGAGCCAGATTCGGACGAGGCAAACAGTGTCTGCCATCATCAAAGACGGCTCCTCCATCAACCT
GTACATGTTCCATGGAGGCACAAATTTTGGCTTCATAAATGGAGCCATGCATTTTAATGACTACAAGGCT
GATGTTACCAGCTATGACTATGATGCTATACTGACAGAGGCTGGAGACTACACTGCCAAATACACCAAGC
TTCGAGAACTCTTTGGAACTGTCTCAGGTATTCCTCCACCTCCTCCACCTGAGCTTACTGCTAAGATGGT
CTATGAGCCAATGAGTCCAGCTCTCTACCTATCACTGTGGGATGCTATCCAGTACATGGATAAGCCAGTC
ACATCTGAGACACCCATCAACATGGAGAACCTGCCAGTAAACAATGGTAATGGGCAGGCCTTTGGGTATG
TTCTGTATGAGACCACTATCTTTTCATCTGGTGTCCTCAGTGGCCTCGTGCGTGACAGAGGACAGGTCTT
TTTGAATAGAGTATCCATAGGATTCCTGGACTATAAAACAACAAAGATCACTATCCCTTTGACCCAGGGT
TACACCATA
Notes:The probe template was PCR amplified from IMAGE:439614 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:439614 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008223 same experiment
 EMAGE:21312 same embryo
 EMAGE:21313 same embryo
 EMAGE:21310 same embryo
 EMAGE:21311 same embryo
 EMAGE:21314 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS