Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21451

Akr1b8 aldo-keto reductase family 1, member B8 ( MGI:107673)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21451 EMAGE:21451 EMAGE:21451 EMAGE:21451 EMAGE:21451
"Pseudo-wholemount" of euxassay_000866. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000866_01 euxassay_000866_02 euxassay_000866_03 euxassay_000866_04
EMAGE:21451 EMAGE:21451 EMAGE:21451 EMAGE:21451 EMAGE:21451
euxassay_000866_05 euxassay_000866_06 euxassay_000866_07 euxassay_000866_08 euxassay_000866_09
EMAGE:21451 EMAGE:21451 EMAGE:21451 EMAGE:21451 EMAGE:21451
euxassay_000866_10 euxassay_000866_11 euxassay_000866_12 euxassay_000866_13 euxassay_000866_14
EMAGE:21451 EMAGE:21451 EMAGE:21451 EMAGE:21451 EMAGE:21451
euxassay_000866_15 euxassay_000866_16 euxassay_000866_17 euxassay_000866_18 euxassay_000866_19
EMAGE:21451 EMAGE:21451 EMAGE:21451 EMAGE:21451 EMAGE:21451
euxassay_000866_20 euxassay_000866_21 euxassay_000866_22 euxassay_000866_23 euxassay_000866_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21451Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21451_wholemount_strong.wlz
21451_wholemount_moderate.wlz
21451_wholemount_weak.wlz
21451_wholemount_possible.wlz
21451_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21451_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
strong strong
homogeneousstrong expression: see section 1 2 3 0 1 2
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 4 5 6
medulla oblongata basal plate
moderate moderate
homogeneousmoderate expression: see section 0 1 8 9 weak expression: see section 8 0
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 8 2 3 weak expression: see section 4
inferior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 9 1
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 6 7 8 9 0 9 0 1 2 3 weak expression: see section 4
superior vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 0 0
vestibulocochlear viii ganglion cochlear component
moderate moderate
homogeneousmoderate expression: see section 7 8 9 0 1 2
vestibulocochlear viii ganglion vestibular component
moderate moderate
homogeneousmoderate expression: see section 6 7 8 9 0 9 0 1 2
ventral grey horn
moderate moderate
regionalmoderate expression: see section 8 9 weak expression: see section 3 5 6
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T899
Entity Detected:Akr1b8, aldo-keto reductase family 1, member B8 ( MGI:107673)
Sequence:sense strand is shown

>T899
CCTCGAGNCTGTTGGCCTACTGGCTCATTAACAAGGACACAGACATCTGCTCTCAGCAAGATTTTGGCAG
CAACCATGGCCACGTTCGTGGAACTCAGTACCAAAGCCAAGATGCCCATTGTGGGCCTGGGCACCTGGAA
GTCTCCCCCAAACCAAGTCAAAGAAGCTGTGAAGGCGGCCATTGACGCTGGGTATCGCCATATCGACTGC
GCGTATGCCTATTGCAACGAGAATGAGGTGGGAGAAGCCATCCAAGAGAAGATCAAAGAGAAGGCTGTGC
AGCGGGAGGACCTCTTCATTGTCAGCAAGCTGTGGCCCACCTGCTTTGAGAAGAAACTGCTAAAGGAAGC
CTTTCAGAAGACCCTCACGGATCTGAAGCTGGACTATTTGGACCTCTATCTTATTCACTGGCCACAGGGA
CTTCAGCCAGGAAAGGAGTTATTCCCCAAAGATGACCAAGGCAGAATCCTCACCAGTAAGACAACATTCT
TGGAAGCCTGGGAGGGCATGGAGGAACTGGTGGACCAGGGGCTGGTGAAAGCTCTGG
Notes:The probe template was PCR amplified from IMAGE:1924350 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1924350 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000866 same experiment
 EMAGE:21453 same embryo
 EMAGE:21450 same embryo
 EMAGE:21454 same embryo
 EMAGE:21455 same embryo
 EMAGE:21452 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS