Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21613

Irx5 Iroquois related homeobox 5 (Drosophila) ( MGI:1859086)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21613 EMAGE:21613 EMAGE:21613 EMAGE:21613 EMAGE:21613
"Pseudo-wholemount" of euxassay_007520. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007520_01 euxassay_007520_02 euxassay_007520_03 euxassay_007520_04
EMAGE:21613 EMAGE:21613 EMAGE:21613 EMAGE:21613 EMAGE:21613
euxassay_007520_05 euxassay_007520_06 euxassay_007520_07 euxassay_007520_08 euxassay_007520_09
EMAGE:21613 EMAGE:21613 EMAGE:21613 EMAGE:21613 EMAGE:21613
euxassay_007520_10 euxassay_007520_11 euxassay_007520_12 euxassay_007520_13 euxassay_007520_14
EMAGE:21613 EMAGE:21613 EMAGE:21613 EMAGE:21613 EMAGE:21613
euxassay_007520_15 euxassay_007520_16 euxassay_007520_17 euxassay_007520_18 euxassay_007520_19
EMAGE:21613 EMAGE:21613 EMAGE:21613 EMAGE:21613
euxassay_007520_20 euxassay_007520_21 euxassay_007520_22 euxassay_007520_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21613Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21613_wholemount_strong.wlz
21613_wholemount_moderate.wlz
21613_wholemount_weak.wlz
21613_wholemount_possible.wlz
21613_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21613_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 moderate expression: see section 7
humerus
strong strong
regionalstrong expression: see section 1 2 3 2 3 moderate expression: see section 4 0 1
foot
strong strong
regionalstrong expression: see section 3
fibula
strong strong
regionalstrong expression: see section 1 2 1 2 3
tibia
strong strong
regionalstrong expression: see section 1 2 1 2 3
femur
strong strong
regionalstrong expression: see section 1 2 3 4 5 7 8 9 0 1 2 3 moderate expression: see section 6 7
skin
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3
meckel's cartilage
strong strong
regionalstrong expression: see section 7 8 9 0 1 7 8 9 0 1 2 moderate expression: see section 1 2 3 4 5 6 2 5 6
axial skeleton
strong strong
regionalstrong expression: see section 5 6 7 8 9 0 1 2 3 4 5 6
cranium
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3
scapula
strong strong
regionalstrong expression: see section 1 2 3
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 7 8 5
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2668
Entity Detected:Irx5, Iroquois related homeobox 5 (Drosophila) ( MGI:1859086)
Sequence:sense strand is shown

>T2668
TGATGGAAAAATAACTGCCAAGGCCATGGTTTTAATAAATTAGGAAAGTCCGGGGATACCGCACCAGAGT
TAAATGTCGGACATACCTTTCTTCAACTCATAGGGGGAGTCTTTGCACAGGTCTAGCTGAGACTGGCTCC
GCAACATTTTCGGGTCTTTAGCCAAAACGTCCGCACGATTCAACACCGTCTGGTTTAATCCATTGAAATG
AGAGCCAGGACCCGCTGTAGGGCTTGGCCCTGGCCCTGGGTGGCCGTGAAGATGTCCGAAGGAGCCATAG
TTCGTGTAGCCCGGATAGAAGGGCGCCGTGTAATAAAGAGGCCGGGACAGCACCGTCCCGCCCGGAAAGG
GACACTGCGCGGAGGGTGAGCGTGCGGGCGCTGGGGCAGGAGACGCGCGGCTGCCTCCAAGCGTTTGCCC
GCCCATGGGCCCTGGGCACGGTGGGCATGGAGAGCCCTCGCTCCCTCCGCCCCCGTCCTTGACCTTGTCC
GAGGATGTGGCGATCTCGGCCAGAGACCACAGTTTGGGCTTGGCTAGCACGGCCGGAGGC
Notes:The probe template was PCR amplified from IMAGE:1511139 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1511139 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007520 same experiment
 EMAGE:21616 same embryo
 EMAGE:21615 same embryo
 EMAGE:21617 same embryo
 EMAGE:21614 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS