Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29493

1700016D18Rik (1700016D18Rik)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:29493 EMAGE:29493 EMAGE:29493 EMAGE:29493 EMAGE:29493
euxassay_016692_01 euxassay_016692_02 euxassay_016692_03 euxassay_016692_04 euxassay_016692_05
EMAGE:29493 EMAGE:29493 EMAGE:29493 EMAGE:29493 EMAGE:29493
euxassay_016692_06 euxassay_016692_07 euxassay_016692_08 euxassay_016692_09 euxassay_016692_10
EMAGE:29493 EMAGE:29493 EMAGE:29493 EMAGE:29493 EMAGE:29493
euxassay_016692_11 euxassay_016692_12 euxassay_016692_13 euxassay_016692_14 euxassay_016692_15
EMAGE:29493 EMAGE:29493 EMAGE:29493 EMAGE:29493 EMAGE:29493
euxassay_016692_16 euxassay_016692_17 euxassay_016692_18 euxassay_016692_19 euxassay_016692_20
EMAGE:29493 EMAGE:29493 EMAGE:29493
euxassay_016692_21 euxassay_016692_22 euxassay_016692_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40127
Entity Detected:1700016D18Rik, (1700016D18Rik)
Sequence:sense strand is shown

>T40127
AGACTTGGCCGAGAGCATAATGAAGAACCTTAGGCGGGTGCATCCCATTTCCACCATGATTACGGGTCTC
TATGGAATCAATGATGATGTCTTCCTCAGTGTCCCGTGTATCCTGGGACGAAATGGAATCTCGGATGTTG
TGAAGGTGACACTGACTCCCGAGGACGAGGCCCGCCTGAAGAAGAGCGCAGACGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 276859. Forward Primer - name:276859_F_cDNA_LOC545070, sequence:AGACTTGGCCGAGAGCATAA; Reverse Primer - name:276859_N_SP6_cDNA_LOC545070, sequence:GGCGTCTGCGCTCTTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016692 same experiment
 EMAGE:29835 same embryo
 EMAGE:29492 same embryo
 EMAGE:29838 same embryo
 EMAGE:29494 same embryo
 EMAGE:29832 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS