Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29647

Tpsg1 ( MGI:1349391)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:29647 EMAGE:29647 EMAGE:29647 EMAGE:29647 EMAGE:29647
euxassay_000458_01 euxassay_000458_02 euxassay_000458_03 euxassay_000458_04 euxassay_000458_05
EMAGE:29647 EMAGE:29647 EMAGE:29647 EMAGE:29647 EMAGE:29647
euxassay_000458_06 euxassay_000458_07 euxassay_000458_08 euxassay_000458_09 euxassay_000458_10
EMAGE:29647 EMAGE:29647 EMAGE:29647 EMAGE:29647 EMAGE:29647
euxassay_000458_11 euxassay_000458_12 euxassay_000458_13 euxassay_000458_14 euxassay_000458_15
EMAGE:29647 EMAGE:29647 EMAGE:29647 EMAGE:29647 EMAGE:29647
euxassay_000458_16 euxassay_000458_17 euxassay_000458_18 euxassay_000458_19 euxassay_000458_20
EMAGE:29647 EMAGE:29647 EMAGE:29647 EMAGE:29647
euxassay_000458_21 euxassay_000458_22 euxassay_000458_23 euxassay_000458_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2340
Entity Detected:Tpsg1, ( MGI:1349391)
Sequence:sense strand is shown

>T2340
TTCGTCGACATGCTGATGGCCAAGTACTGGCTGAGCTCTCCCTCCCACGCGGCCTCGGAACTCTGAATGA
GGTGTAGCAACCAACCCAAGTGTCTTTCTTAAATAAGTTAGTGTTTATTCAGCTTTGCTTTGCCCCTCCC
NTCCCCTTAGCTTTGACTTAGGAAGCCAAGTTTTCTGCATCAGATTATTGCAACATTTAACCTGAATTTG
TAGAACGGATGACATAAAGCAAATGGATGTCAAATGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1176767 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1176767 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000458 same experiment
 EMAGE:30281 same embryo
 EMAGE:31108 same embryo
 EMAGE:30284 same embryo
 EMAGE:30300 same embryo
 EMAGE:31107 same embryo
 EMAGE:30312 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS