Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30148

Cyp4f15 cytochrome P450, family 4, subfamily f, polypeptide 15 ( MGI:2146921)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30148 EMAGE:30148 EMAGE:30148 EMAGE:30148 EMAGE:30148
euxassay_012519_01 euxassay_012519_02 euxassay_012519_03 euxassay_012519_04 euxassay_012519_05
EMAGE:30148 EMAGE:30148 EMAGE:30148 EMAGE:30148 EMAGE:30148
euxassay_012519_06 euxassay_012519_07 euxassay_012519_08 euxassay_012519_09 euxassay_012519_10
EMAGE:30148 EMAGE:30148 EMAGE:30148 EMAGE:30148 EMAGE:30148
euxassay_012519_11 euxassay_012519_12 euxassay_012519_13 euxassay_012519_14 euxassay_012519_15
EMAGE:30148 EMAGE:30148 EMAGE:30148 EMAGE:30148 EMAGE:30148
euxassay_012519_16 euxassay_012519_17 euxassay_012519_18 euxassay_012519_19 euxassay_012519_20
EMAGE:30148 EMAGE:30148 EMAGE:30148 EMAGE:30148
euxassay_012519_21 euxassay_012519_22 euxassay_012519_23 euxassay_012519_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31406
Entity Detected:Cyp4f15, cytochrome P450, family 4, subfamily f, polypeptide 15 ( MGI:2146921)
Sequence:sense strand is shown

>T31406
GGAGAAGGTGCCTGGCTAAGAGTAGGTTAAAGAGAACTCTAAGCCTGAACCTGGCTGCTTATTTCTAGAT
AACCAGCTATCTGAAGCCAAAAAGTCAGAGTGATCCTGTTGGCTTCAGACATGGGGTTTTTCAGGATGCC
ACAGTTGGACCTGTCTTGGCTGGGACTGAGGCTGGAGGCATCCTCACCATGGCTGCTTTTGCTGCTGATC
GGAGCTTCCTGGCTCTTGGCCCGTGTCCTGACTCAGACCTATATCTTCTACAGAACATATCATCATCTTT
GTGATTTCCCTCAACCCCCCAAATGGAATTGGTTCTTGGGTCACCTAGGCATGATCACACCCACTGAGCA
TGGTCTGAAGGAGGTGACTAACCTGGTGGCCACCTACCCCCAGGGCTTCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5050617), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 24467. Forward Primer - name:024467_F_IRAV55-58_N18_Cyp4f15, sequence:GGAGAAGGTGCCTGGCTA; Reverse Primer - name:024467_R_SP6_IRAV55-58_N18_Cyp4f15, sequence:ATGAAGCCCTGGGGGTA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012519 same experiment
 EMAGE:31062 same embryo
 EMAGE:31054 same embryo
 EMAGE:31085 same embryo
 EMAGE:30139 same embryo
 EMAGE:30103 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS