EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30575

H2-Ke2 ( MGI:95908)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_001986_01	euxassay_001986_02	euxassay_001986_03	euxassay_001986_04	euxassay_001986_05

euxassay_001986_06	euxassay_001986_07	euxassay_001986_08	euxassay_001986_09	euxassay_001986_10

euxassay_001986_11	euxassay_001986_12	euxassay_001986_13	euxassay_001986_14	euxassay_001986_15

euxassay_001986_16	euxassay_001986_17	euxassay_001986_18	euxassay_001986_19	euxassay_001986_20

euxassay_001986_21	euxassay_001986_22	euxassay_001986_23

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T1151
Entity Detected:	H2-Ke2, ( MGI:95908)
Sequence:	sense strand is shown >T1151 CCTCGAGNCTGTTGGCCTACTGGATTATTGATTACAGCGGGTAGAGCGTGAAGAGGTTAGCGTTTGGCTT GGAGGGTTCGGGGATCTCTTCTTTCGCTCTCCTTTGCCTAGGGAGTGGCTATTCTGGACGAAAAGAGGCT GCGGCGCCTCGGAGAGTTGCGGGTAGAAAGTGCTGTCCTTCTGCAGGGTCAGGGAGGGGGGATTCAGGTG CCTCCCAGAGCTTGAGACCCAGCGACCCCCGCCCAGGAGGCTTTCTCCTTCACCATGGCTGAACTGATCC AAAAGAAGCTGCAGGGAGAGGTAGAGAAATATCAACAGCTGCAGAAGGACTTGAGTAAATCTATGTCAGG GAGGCAGAAGCTCGAAGCACAGCTAACGGAAAACAATATCGTGAAGGAGGAGCTGGCCCTGCTGGATGGA TCCAACGTGGTCTTTAAGCTTCTGGGACCCGTGCTTGTCAAACAGGAGCTGGGGGAGGCTCGGGCCACAG TAGGGAAGAGGCTAGACTACATCACAGCAGAAATCAAGCGCTACGAATCACAGCTTCGGGACCTCGAGCG GCAGTCAGAGCA
Notes:	The probe template was PCR amplified from IMAGE:2136446 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2136446 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_001986 same experiment
	EMAGE:31802 same embryo
	EMAGE:31010 same embryo
	EMAGE:31794 same embryo
	EMAGE:29315 same embryo
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source