EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30582

Fbn1 ( MGI:95489)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_008109_01	euxassay_008109_02	euxassay_008109_03	euxassay_008109_04	euxassay_008109_05

euxassay_008109_06	euxassay_008109_07	euxassay_008109_08	euxassay_008109_09	euxassay_008109_10

euxassay_008109_11	euxassay_008109_12	euxassay_008109_13	euxassay_008109_14	euxassay_008109_15

euxassay_008109_16	euxassay_008109_17	euxassay_008109_18	euxassay_008109_19	euxassay_008109_20

euxassay_008109_21	euxassay_008109_22

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T36366
Entity Detected:	Fbn1, ( MGI:95489)
Sequence:	sense strand is shown >T36366 ACAACAAGGTCCGAATCCTAGAGCTCCTGCCGGCCCTCACAACTCTGATGAACCACAACAGATACTTGAT TGAATCTGGAAATGAAGATGGCTTCTTTAAAATCAACCAGAAAGAAGGGGTCAGCTACCTCCACTTCACG AAGAAGAAGCCGGTGGCTGGGACCTACTCCTTACAAATCAGCAGCACCCCACTTTATAAAAAGAAAGAAC TTAACCAGTTAGAAGACAGATATGACAAAGACTACCTCAGTGGTGAACTGGGCGATAACCTGAAGATGAA AATTCAGATCTTGCTGCATTAATTCACCATCCAGAGACCAAATAATTAAATGAAAAAGCAACCTTAGGCA GGTAGAATTATATTTTCCCCAAGCCAGAACCTTCACATCATGGTACAATTGTTCACCGAGTCGATCTGTA TAAATGAGCACCACTCTTGAATGGCAACACCCAGGTACAGTGATGATCCTAGTTCAACCAACCACTTTCT CAGGCTTCTCGTGAGTAGCTCAGCTACCCTGTCATGCGTATTGATTCCTGAAAACTGGGACATGAATATC CGCTGAGGTTGGCCATTCACGCCGATGGGCTATCTTCCCAGCCTCCGCACAGGAACGCGCTTCCATCTGA TGGACTGTTCCGCGTTGGTCTTCAGATCTTGAAACTTTGCTTCTCCGAGTGCAAGCAGTAGGTTTCTGTT GTCTGTTTGGTGCTAGTAAATTCTCAAAATAGATTTATTGATGCACTGTAATAACGACACGAGTT
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97714. Forward Primer - name:097714_F_cDNA_Fbn1, sequence:ACAACAAGGTCCGAATCCTAGA; Reverse Primer - name:097714_N_SP6_cDNA_Fbn1, sequence:AACTCGTGTCGTTATTACAGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_008109 same experiment
	EMAGE:31889 same embryo
	EMAGE:30613 same embryo
	EMAGE:29815 same embryo
	EMAGE:29817 same embryo
	EMAGE:29799 same embryo
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source