Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30810

C1qtnf2 ( MGI:1916433)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30810 EMAGE:30810 EMAGE:30810 EMAGE:30810 EMAGE:30810
euxassay_011625_01 euxassay_011625_02 euxassay_011625_03 euxassay_011625_04 euxassay_011625_05
EMAGE:30810 EMAGE:30810 EMAGE:30810 EMAGE:30810 EMAGE:30810
euxassay_011625_06 euxassay_011625_07 euxassay_011625_08 euxassay_011625_09 euxassay_011625_10
EMAGE:30810 EMAGE:30810 EMAGE:30810 EMAGE:30810 EMAGE:30810
euxassay_011625_11 euxassay_011625_12 euxassay_011625_13 euxassay_011625_14 euxassay_011625_15
EMAGE:30810 EMAGE:30810 EMAGE:30810 EMAGE:30810 EMAGE:30810
euxassay_011625_16 euxassay_011625_17 euxassay_011625_18 euxassay_011625_19 euxassay_011625_20
EMAGE:30810 EMAGE:30810
euxassay_011625_21 euxassay_011625_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
mandible
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 14 15 16 17 18 19 20 21 22 moderate expression: see section 02 03
temporal bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 22
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05
clavicle
moderate moderate
regionalmoderate expression: see section 06 07 08 09 17 18 19
rib
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 15 18 19 20 21 22
axial skeleton
strong strong
regionalstrong expression: see section 15 moderate expression: see section 13 14
viscerocranium
strong strong
regionalstrong expression: see section 05 06 07 08 09 16 17 18 19
otic capsule
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 18
bladder
weak weak
regionalweak expression: see section 11 12 13 14
esophagus
weak weak
regionalweak expression: see section 12 13
basioccipital bone
strong strong
regionalstrong expression: see section 05
basisphenoid bone
strong strong
regionalstrong expression: see section 05
foramen ovale of chondrocranium
strong strong
regionalstrong expression: see section 06
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 14 15 16 17 18 19 20 moderate expression: see section 03
nasal septum
strong strong
regionalstrong expression: see section 10 14 15 moderate expression: see section 11 13
exoccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 07 20 21 22
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 18 19 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31686
Entity Detected:C1qtnf2, ( MGI:1916433)
Sequence:sense strand is shown

>T31686
AGCAAAGACGTCGGATGGCCCTGGACGTGGCTCGGGGCACAGAAGCAAGAAGACTTGATGAAGCCTTTCT
TCCCAACCCATTCCCAGAAAGAACAACTTAGATGACAATTTTTAAAAAGGTGACAACCATGATCTCCTGG
GTACTCTTGGCCTGTGCCCTTCCGTGTGCTGCTGACCCAATGCTTGGTGCCTTTGCTCGCAGGGACTTCC
AGAAGGGGGGTCCTCAACTAGTTTGCAGCCTGCCTGGTCCCCAAGGCCCACCTGGCCCTCCAGGAGCACC
AGGATCCTCAGGAGTGGTGGGAAGAATGGGTTTCCCTGGGAAAGACGGCCAAGATGGCCAGGACGGAGAC
CGGGGGGACAGTGGAGAAGAAGGTCCACCTGGCAGGACAGGCAACCGTGGAAAACAAGGACCAAAGGGCA
AAGCTGGGGCCATTGGCAGAGCTGGCCCTCGAGGACCCAAGGGGGTCAGTGGTACCCCCGGGAAGCATGG
CACACCGGGCAAGAAGGGACCTAAGGGCAAAAAAGGGGAGCCTGGCCTCCCAGGCCCCTGCAGCTGCGGC
AGTAGCCGAGCCAAGTCGGCCTTTTCCGTGGCGGTAACCAAGAGCTACCCACGCGAGCGACTGCCTATCA
AGTTTGACAAGATTCTGATGAACGAGGGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5375090), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 32834. Forward Primer - name:032834_F_IRAV81-84_G17_C1qtnf2, sequence:AGCAAAGACGTCGGATGG; Reverse Primer - name:032834_R_SP6_IRAV81-84_G17_C1qtnf2, sequence:GCCACCCTCGTTCATCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011625 same experiment
 EMAGE:29979 same embryo
 EMAGE:30812 same embryo
 EMAGE:31144 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS