Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30822

A530088H08Rik ( MGI:2443635)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30822 EMAGE:30822 EMAGE:30822 EMAGE:30822 EMAGE:30822
euxassay_009308_01 euxassay_009308_02 euxassay_009308_03 euxassay_009308_04 euxassay_009308_05
EMAGE:30822 EMAGE:30822 EMAGE:30822 EMAGE:30822 EMAGE:30822
euxassay_009308_06 euxassay_009308_07 euxassay_009308_08 euxassay_009308_09 euxassay_009308_10
EMAGE:30822 EMAGE:30822 EMAGE:30822 EMAGE:30822 EMAGE:30822
euxassay_009308_11 euxassay_009308_12 euxassay_009308_13 euxassay_009308_14 euxassay_009308_15
EMAGE:30822 EMAGE:30822 EMAGE:30822 EMAGE:30822 EMAGE:30822
euxassay_009308_16 euxassay_009308_17 euxassay_009308_18 euxassay_009308_19 euxassay_009308_20
EMAGE:30822 EMAGE:30822 EMAGE:30822 EMAGE:30822
euxassay_009308_21 euxassay_009308_22 euxassay_009308_23 euxassay_009308_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 07 08 17 18
stomach
weak weak
spottedweak expression: see section 02 03 04 05 06 07 08 09 10 11
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 07 13
tongue
moderate moderate
spottedmoderate expression: see section 13 15 16
rest of cerebellum mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 12 13 14 15 16 17
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 17
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 17
thoracic ganglion
weak weak
regionalweak expression: see section 09 10 11
midgut
weak weak
spottedweak expression: see section 12 13 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 12 13 14 15
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07 17 moderate expression: see section 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 13 14 16 17
cervical ganglion
weak weak
regionalweak expression: see section 07 08 15
midbrain mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 11 12 13 14 15 16 17 moderate expression: see section 04
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35825
Entity Detected:A530088H08Rik, ( MGI:2443635)
Sequence:sense strand is shown

>T35825
CTGTTCCTCCCTACCAAACAAGCAAGTATTTATTGAGTTTCCTTCTCTAGGCCTAGGTTGGGAACAGCCA
GACCCAGTCTCTGATGTCATCTTATTTCCAAAAGTGAAAGAGGGAAAAACATGGCCAAGCCAACTGGCAA
TACTCCATACTGAGTTCTTAGGGTGGCCATGGGAACACATGGATCTAACAAATGTACAGGAAGATAGATT
TCTGGAGACCATGTTCACCCCTTCTGAATATGAAGGGGAAGGAAGTGTTTGGAATGAGCAAGATGTGCAA
GGTAGTCAGCAACTGCCTTGCATGTGGAGAAGCTAAGGGGAAAGAGACAGGGTGGGGTTAGGATTCCGCA
TAGCTCCCGGATGCTATTCCATCCTCTCTTGCCTACTTCCCCCCTGCTTCCCCAGGTACCTTACATCCAG
CTACTCCTTGGTACACTGCAGGCTTCTGGGGTCAATAGGGACTGGGAGGGGCATCTCCAGAGGGCCTAAC
AAGTAGATATAACCCAAGAGGTAAGTACCCTCAAAACTTCATTATAGTCACCAAGACACCTTTAGGCAAA
AGACCGGGCACCTATAAGAAATTTCCAAAGCTGTTCCAGGCAAGGCCAGGCCAGAGAGCAGAGGAAGGTA
CCTAGTAGCAAAGTGAATGACAAGAGCTGCAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 70747. Forward Primer - name:070747_F_cDNA_A530088H08Rik, sequence:CTGTTCCTCCCTACCAAACAAG; Reverse Primer - name:070747_N_SP6_cDNA_A530088H08Rik, sequence:ATGCAGCTCTTGTCATTCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009308 same experiment
 EMAGE:31084 same embryo
 EMAGE:30992 same embryo
 EMAGE:29961 same embryo
 EMAGE:30995 same embryo
 EMAGE:30147 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS