Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30928

V1rd12 ( MGI:3704286)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30928 EMAGE:30928 EMAGE:30928 EMAGE:30928 EMAGE:30928
euxassay_016485_01 euxassay_016485_02 euxassay_016485_03 euxassay_016485_04 euxassay_016485_05
EMAGE:30928 EMAGE:30928 EMAGE:30928 EMAGE:30928 EMAGE:30928
euxassay_016485_06 euxassay_016485_07 euxassay_016485_08 euxassay_016485_09 euxassay_016485_10
EMAGE:30928 EMAGE:30928 EMAGE:30928 EMAGE:30928 EMAGE:30928
euxassay_016485_11 euxassay_016485_12 euxassay_016485_13 euxassay_016485_14 euxassay_016485_15
EMAGE:30928 EMAGE:30928 EMAGE:30928 EMAGE:30928 EMAGE:30928
euxassay_016485_16 euxassay_016485_17 euxassay_016485_18 euxassay_016485_19 euxassay_016485_20
EMAGE:30928 EMAGE:30928 EMAGE:30928 EMAGE:30928
euxassay_016485_21 euxassay_016485_22 euxassay_016485_23 euxassay_016485_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 04 05 06 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38615
Entity Detected:V1rd12, ( MGI:3704286)
Sequence:sense strand is shown

>T38615
AGCTGATGGTCAGAGGAAGAAGCCCCAAGGTCATAAGCTATTCCTGTTGTAGTTGTTGGTTGTTTGGTAT
CTTATATAATGTCTACATTCCAATGAAAGTCAGTGGTCCACAGAACAGACATAATAAAACCAGCACTAAA
AGTAAGTGGGTCTGTTTTACATCTGGCTTCAGTGTCGGCATTGTGTTCTTGTCATTTGCCCATGATGCCA
TATTTATCAGCATCATGGTCTGGGCCAGTGTCTCCATGGTACTTCTCCTGTATAGACACTACCAGAGACT
GCAGTACATTTTCCCTCCCCATCAAGGCAACAGAGGCTATGCTGAGATCAGAGCAGCCCATAGCATTGTG
ATGCTTGTGGTCACATTTGTAAGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 150976. Forward Primer - name:150976_F_cDNA_V1rd12, sequence:AGCTGATGGTCAGAGGAAGAAG; Reverse Primer - name:150976_N_SP6_cDNA_V1rd12, sequence:AGCTTACAAATGTGACCACAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016485 same experiment
 EMAGE:30929 same assay
 EMAGE:30042 same embryo
 EMAGE:30030 same embryo
 EMAGE:30040 same embryo
 EMAGE:30045 same embryo
 EMAGE:30929 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS