Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30994

2810459M11Rik ( MGI:1920042)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30994 EMAGE:30994 EMAGE:30994 EMAGE:30994 EMAGE:30994
euxassay_008051_01 euxassay_008051_02 euxassay_008051_03 euxassay_008051_04 euxassay_008051_05
EMAGE:30994 EMAGE:30994 EMAGE:30994 EMAGE:30994 EMAGE:30994
euxassay_008051_06 euxassay_008051_07 euxassay_008051_08 euxassay_008051_09 euxassay_008051_10
EMAGE:30994 EMAGE:30994 EMAGE:30994 EMAGE:30994 EMAGE:30994
euxassay_008051_11 euxassay_008051_12 euxassay_008051_13 euxassay_008051_14 euxassay_008051_15
EMAGE:30994 EMAGE:30994 EMAGE:30994 EMAGE:30994 EMAGE:30994
euxassay_008051_16 euxassay_008051_17 euxassay_008051_18 euxassay_008051_19 euxassay_008051_20
EMAGE:30994 EMAGE:30994 EMAGE:30994
euxassay_008051_21 euxassay_008051_22 euxassay_008051_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
telencephalon ventricular layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 20
midbrain ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 12 13 14
liver left lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 06 07 08 09 10 11 weak expression: see section 04 05
liver right lobe
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 14 15 16 17 18 20 21
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14
pons ventricular layer
weak weak
regionalweak expression: see section 07 11 12 13 15
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35594
Entity Detected:2810459M11Rik, ( MGI:1920042)
Sequence:sense strand is shown

>T35594
ATATCTCCCACAGAGCCTACCAGGGTATCTATTCATGCAGAAGCAACTGGGGACCACCTCTGTTGCCCCT
GCCTGCCCCTGGAGAAATCCATCTCTGGAAGGACAAAAGCCCTTACTGGTTTTTCCCTGATATGGAGAAA
GCACTGTCAGAGGGGAGTAGACACATCTGTGAGACGCTCTGCAGATACCCAGGTGTGCTGTGCTTCGCAT
AGCTCCCTGTGAGGAGGAGCTGCATACCTCTGAGTCACGATTCAGCTCTTTCTGTGATGATTCGGAGGGA
GAGGACCCTCCCTGCTCCTGCCTCAGTTTCTTCTTGGTGATCCACAGCCTAACCCTATTCCCTCTCAGTC
TCAAGTAGAAACTGTGAAGTCGAAAGAGACAGTGTCTTCCTGGAATGAGGTGGGAGCAGACATCATTTTA
ATAATGCAAGGTTGTACCCCGTAGGAAATGGCCCCAACTAGCATCCTTTATTCAAGAATGAACTCCAGGC
CAGGATGTAGCTCAGTTAGTAGAAGGCTAGCCTAGAATGCTAGTTTGATCCCCATCATGTATAAACTGGA
TGAAGTGCATATGCCTATAACCCCAGTTCTTTGGAAGTAGAGAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75777. Forward Primer - name:075777_F_cDNA_2810459M11Rik, sequence:ATATCTCCCACAGAGCCTACCA; Reverse Primer - name:075777_N_SP6_cDNA_2810459M11Rik, sequence:ATCTCTACTTCCAAAGAACTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008051 same experiment
 EMAGE:30071 same embryo
 EMAGE:30328 same embryo
 EMAGE:30068 same embryo
 EMAGE:30099 same embryo
 EMAGE:30997 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS