Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30996

Pcsk1n proprotein convertase subtilisin/kexin type 1 inhibitor ( MGI:1353431)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30996 EMAGE:30996 EMAGE:30996 EMAGE:30996 EMAGE:30996
euxassay_011459_01 euxassay_011459_02 euxassay_011459_03 euxassay_011459_04 euxassay_011459_05
EMAGE:30996 EMAGE:30996 EMAGE:30996 EMAGE:30996 EMAGE:30996
euxassay_011459_06 euxassay_011459_07 euxassay_011459_08 euxassay_011459_09 euxassay_011459_10
EMAGE:30996 EMAGE:30996 EMAGE:30996 EMAGE:30996 EMAGE:30996
euxassay_011459_11 euxassay_011459_12 euxassay_011459_13 euxassay_011459_14 euxassay_011459_15
EMAGE:30996 EMAGE:30996 EMAGE:30996 EMAGE:30996 EMAGE:30996
euxassay_011459_16 euxassay_011459_17 euxassay_011459_18 euxassay_011459_19 euxassay_011459_20
EMAGE:30996 EMAGE:30996 EMAGE:30996 EMAGE:30996
euxassay_011459_21 euxassay_011459_22 euxassay_011459_23 euxassay_011459_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 23 24
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 19 20
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 12 13 17 18
spinal cord
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 16 17 18
brain
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 01 02 03 04 05
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 09 moderate expression: see section 08 20
trigeminal v nerve
strong strong
regionalstrong expression: see section 18 moderate expression: see section 10 11 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 19 moderate expression: see section 09 10 11 12 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 19 moderate expression: see section 10
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23
cervical ganglion
moderate moderate
regionalmoderate expression: see section 11 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30138
Entity Detected:Pcsk1n, proprotein convertase subtilisin/kexin type 1 inhibitor ( MGI:1353431)
Sequence:sense strand is shown

>T30138
GTCGGCATTTTGGTGCTGCTGCTCTTGGGCCTTCTGAGGCTGCCCCCCACCCTGTCAGCGAGGCCCGTGA
AGGAGCCCCGCAGTCTGAGCGCAGCATCCGCGCCCTTGGTTGAGACGAGCACTCCCCTCCGCTTGCGTCG
GGCCGTGCCCCGAGGAGAGGCGGCGGGTGCGGTGCAGGAGCTGGCGCGGGCGCTGGCGCACCTGCTGGAG
GCCGAGAGACAGGAACGCGCGCGTGCTGAGGCGCAGGAGGCTGAGGATCAGCAGGCGCGTGTCCTGGCGC
AGCTGCTGCGCGCCTGGGGCTCTCCGCGTGCCTCGGACCCGCCCTTGGCCCCCGACGATGACCCGGACGC
TCCAGCTGCACAGCTCGCCCGTGCTCTGCTCCGAGCTCGCCTAGACCCGGCCGCCCTGGCAGCCCAACTT
GTCCCCGCCCCTGCCGCTGCGCCGCGACCCCGGCCCCCAGTGTATGATGATGGCCCCACTGGCCCAGACG
TCGAGGATGCCGGCGACGAGACTCCTGACGTGGACCCTGAGCTGCTGAGGTACTTGCTAGGGCGGATCCT
CACCGGAAGTTCGGAGCCAGAGGCTGCTCCTGCCCCGCGCCGCCTCCGCCGATCTGTGGACCAGGATTTG
GGTCCCGAGGTGCCCCCTGAGAACGTACTGGGGGCTCTGCTACGCGTCAAACGCCTGGAGAACCCCTCGC
CCCAGGCGCCGGCACGCCGCCTCCTGCCTCCCTGAGCGCTGCTGCATCCTGCACGCCCTGGAACCCAGGA
GCGCCCCAGCAACCCTGACTCCCTGCCAGCACGTCCAAGGCTGCTTACCCCAGCAACCTCCCATCCCCTG
AGCCCTCAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4207854), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9239. Forward Primer - name:ABA_MGC_005_02_G10_F_CGACGATAGCAGCTGGGT_ABA_REV_00, sequence:GTCGGCATTTTGGTGCTG; Reverse Primer - name:_R_SP6_ABA_MGC_006_02_F11_GTCGGCATTTTGGTGCTGCTGCTC, sequence:ATTGAGGGCTCAGGGGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011459 same experiment
 EMAGE:31020 same embryo
 EMAGE:29337 same embryo
 EMAGE:29326 same embryo
 EMAGE:31027 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS