Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31036

BC003331 ( MGI:2385108)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31036 EMAGE:31036 EMAGE:31036 EMAGE:31036 EMAGE:31036
euxassay_000540_01 euxassay_000540_02 euxassay_000540_03 euxassay_000540_04 euxassay_000540_05
EMAGE:31036 EMAGE:31036 EMAGE:31036 EMAGE:31036 EMAGE:31036
euxassay_000540_06 euxassay_000540_07 euxassay_000540_08 euxassay_000540_09 euxassay_000540_10
EMAGE:31036 EMAGE:31036 EMAGE:31036 EMAGE:31036 EMAGE:31036
euxassay_000540_11 euxassay_000540_12 euxassay_000540_13 euxassay_000540_14 euxassay_000540_15
EMAGE:31036 EMAGE:31036 EMAGE:31036 EMAGE:31036 EMAGE:31036
euxassay_000540_16 euxassay_000540_17 euxassay_000540_18 euxassay_000540_19 euxassay_000540_20
EMAGE:31036 EMAGE:31036 EMAGE:31036 EMAGE:31036
euxassay_000540_21 euxassay_000540_22 euxassay_000540_23 euxassay_000540_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
nasal septum mesenchyme
strong strong
regionalstrong expression: see section 04 05 10 11
vomeronasal organ mesenchyme
strong strong
regionalstrong expression: see section 10 11 13 14 16 17
not examined not examined
othernot examined expression: see section 19
sphenoid bone
strong strong
regionalstrong expression: see section 01 03 04 07 12 21 24 moderate expression: see section 22 23
viscerocranium
strong strong
regionalstrong expression: see section 19
otic capsule
strong strong
regionalstrong expression: see section 01 02 03 04 16 17 20 21 moderate expression: see section 24
facial bone primordium
strong strong
regionalstrong expression: see section 01 02 06 09 19 20 24
choroid invagination
strong strong
regionalstrong expression: see section 19
optic foramen
moderate moderate
regionalmoderate expression: see section 23
arm muscle
moderate moderate
regionalmoderate expression: see section 24
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 04
spinal cord meninges
strong strong
regionalstrong expression: see section 05 09 10 13 14 17 18 19 20 21
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 05 10 11 13 14 15 16
nasal cavity epithelium
strong strong
regionalstrong expression: see section 13
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 17 18 19
nasal cavity
strong strong
regionalstrong expression: see section 05 14 15
spinal cord pia mater
strong strong
regionalstrong expression: see section 20 21
spinal cord dura mater
strong strong
regionalstrong expression: see section 17 20 21
orbito-sphenoid
strong strong
regionalstrong expression: see section 06 07 19 20 moderate expression: see section 22
inner ear
strong strong
regionalstrong expression: see section 21
mandible
strong strong
regionalstrong expression: see section 19 20 21 moderate expression: see section 22
palatal shelf mesenchyme
strong strong
regionalstrong expression: see section 13
head mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 05 06 07 08 09
inner ear vestibular component
strong strong
regionalstrong expression: see section 01 02 03 04 moderate expression: see section 24
mesenchyme
strong strong
regionalstrong expression: see section 03
palatal shelf
strong strong
regionalstrong expression: see section 13
body-wall mesenchyme
strong strong
regionalstrong expression: see section 03
trunk mesenchyme
strong strong
regionalstrong expression: see section 01 02
hindbrain meninges
strong strong
regionalstrong expression: see section 02 03 04
meckel's cartilage
strong strong
regionalstrong expression: see section 10 11 12 14 weak expression: see section 15
basisphenoid bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 12 21 24 moderate expression: see section 22
labyrinth mesenchyme
strong strong
regionalstrong expression: see section 20 21
labyrinth
moderate moderate
regionalmoderate expression: see section 24
nucleus pulposus
strong strong
regionalstrong expression: see section 12 14
lower jaw mesenchyme
strong strong
regionalstrong expression: see section 10 11 19 20 21 moderate expression: see section 22 not examined expression: see section 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1780
Entity Detected:BC003331, ( MGI:2385108)
Sequence:sense strand is shown

>T1780
CTCGAGGCCAGATTCGGATCCATGAGAAATGGTGTTTATCTGATTAATGGACAAGTTAAAGGCAACGATT
GTGACTTATTAGAAGGACAGAAAAAAAGCAGAGGAAATACGCAAGCAACTGCTCATTCTTTTGATGTCCG
AGTGCTAACACAGTTGCTCCTGAATTCGGACCACAGATCCACAGCCACAGTCCAAATCTGCAGTGGTTCT
GTAAATCTTCGGGGAAATGTGAAATGCAGAGCTTATATCCATAGCAACAGACCCAAGGTTAAAGATGCTG
TGCAGGCAGTGAAGAGAGATATTTTGAACACAGTTGCTGATCGCTGTGAAATACTCTTTGAGGACCTGCT
TCTGAATGAAATTCCAGAAAAAAAAAATTATGAACTTCCTCAGAGAGTTTTTGTTCCCCTTCCTGGATCT
ACTGTAATGTTATGTGACTATAAGTTTGGTGATGAATCAGCTGAAGAAATCAGAGACCATTTTTCAGAGA
TGTTAGATCATGAGATTCAAATAGAAGACTTGGAAATTGCAGAGGAAGTAAACACAGCTTGCATGACTTC
CTCTGTGAATAGTGA
Notes:The probe template was PCR amplified from IMAGE:571407 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:571407 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000540 same experiment
 EMAGE:30117 same embryo
 EMAGE:30127 same embryo
 EMAGE:30600 same embryo
 EMAGE:30962 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS