Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31063

Neurod2 neurogenic differentiation 2 ( MGI:107755)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31063 EMAGE:31063 EMAGE:31063 EMAGE:31063 EMAGE:31063
euxassay_013855_01 euxassay_013855_02 euxassay_013855_03 euxassay_013855_04 euxassay_013855_05
EMAGE:31063 EMAGE:31063 EMAGE:31063 EMAGE:31063 EMAGE:31063
euxassay_013855_06 euxassay_013855_07 euxassay_013855_08 euxassay_013855_09 euxassay_013855_10
EMAGE:31063 EMAGE:31063 EMAGE:31063 EMAGE:31063 EMAGE:31063
euxassay_013855_11 euxassay_013855_12 euxassay_013855_13 euxassay_013855_14 euxassay_013855_15
EMAGE:31063 EMAGE:31063 EMAGE:31063 EMAGE:31063 EMAGE:31063
euxassay_013855_16 euxassay_013855_17 euxassay_013855_18 euxassay_013855_19 euxassay_013855_20
EMAGE:31063 EMAGE:31063 EMAGE:31063 EMAGE:31063
euxassay_013855_21 euxassay_013855_22 euxassay_013855_23 euxassay_013855_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 01
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 04 05 23 24
olfactory cortex mantle layer
strong strong
regionalstrong expression: see section 19 moderate expression: see section 11 12 17 18
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 08
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 05 18 19 21 weak expression: see section 04 06 07 08 09 10 13 14 15 16 17 20
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 17 18 19 21 weak expression: see section 04 07 08 09 10 13 14 15 16 20
pons mantle layer
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 07 08
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38228
Entity Detected:Neurod2, neurogenic differentiation 2 ( MGI:107755)
Sequence:sense strand is shown

>T38228
GAGTACGAGGGTCCACTCAGTCCCCCGCTCTGTCTCAACGGCAACTTCTCGCTCAAGCAGGACTCGTCCC
CCGATCACGAGAAGAGCTACCACTACTCTATGCACTACTCGGCGCTGCCCGGCTCACGGCCCACGGGCCA
CGGGCTGGTCTTCGGCTCGTCGGCCGTGCGCGGGGGCGTCCACTCCGAGAATCTCTTGTCTTACGATATG
CACCTTCACCACGATCGGGGCCCCATGTACGAGGAGCTCAACGCATTTTTCCATAACTGAGACCTCNCGC
CGACCCCTTCTTTTTCTTTGCCTTTGTCCGGCCCCTTAGCCCCAGCCCCANNAGCTCAGGGAGCTCCCAC
CGACTCCAGAGCCGGGCNCTCGNCNCGCCGCCGGTTCTGCAGCTCTCCAGAGCGGCGTGCTCTCTTACCT
GTGGGTGGCCCGTCCCAGGGGCCTCGCTTGCCTCTGGGGACTCGCCTTCTCTCTCTCCCCAGCGGCTTCC
TCCTCCCTTCTCTCGTGGAGAGCATCTCTNNNGATCTCCCGCCAGCCCTCCCAAGAGACTTCCTCCACAT
TCCCAAACTTGGGTTTTCTCTCCCCACCTCCAACAGGCCAGAGGAGTTGGTAAGGGGTGCTGAGTCTCGG
GATAGTGTCTCCCCACTTAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 143235. Forward Primer - name:143235_F_cDNA_Neurod2, sequence:GAGTACGAGGGTCCACTCAGTC; Reverse Primer - name:143235_N_SP6_cDNA_Neurod2, sequence:ATAAGTGGGGAGACACTATCCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_013855 same experiment
 EMAGE:30153 same embryo
 EMAGE:31066 same embryo
 EMAGE:30150 same embryo
 EMAGE:30090 same embryo
 EMAGE:30159 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS