Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31074

Phex ( MGI:107489)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31074 EMAGE:31074 EMAGE:31074 EMAGE:31074 EMAGE:31074
euxassay_000526_01 euxassay_000526_02 euxassay_000526_03 euxassay_000526_04 euxassay_000526_05
EMAGE:31074 EMAGE:31074 EMAGE:31074 EMAGE:31074 EMAGE:31074
euxassay_000526_06 euxassay_000526_07 euxassay_000526_08 euxassay_000526_09 euxassay_000526_10
EMAGE:31074 EMAGE:31074 EMAGE:31074 EMAGE:31074 EMAGE:31074
euxassay_000526_11 euxassay_000526_12 euxassay_000526_13 euxassay_000526_14 euxassay_000526_15
EMAGE:31074 EMAGE:31074 EMAGE:31074 EMAGE:31074 EMAGE:31074
euxassay_000526_16 euxassay_000526_17 euxassay_000526_18 euxassay_000526_19 euxassay_000526_20
EMAGE:31074 EMAGE:31074 EMAGE:31074 EMAGE:31074
euxassay_000526_21 euxassay_000526_22 euxassay_000526_23 euxassay_000526_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
basisphenoid bone
strong strong
regionalstrong expression: see section 03
leg muscle
strong strong
regionalstrong expression: see section 05
arm
strong strong
regionalstrong expression: see section 03
arm muscle
strong strong
regionalstrong expression: see section 03
lower jaw tooth
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 17 18 19 20 21 22 23
upper jaw tooth
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 17 18 19 21 22 23
forelimb
strong strong
regionalstrong expression: see section 03
sphenoid bone
strong strong
regionalstrong expression: see section 03 04 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2147
Entity Detected:Phex, ( MGI:107489)
Sequence:sense strand is shown

>T2147
GGCTNATATAAATACGTGCATTCCTTCTAAGTTTCCTTTTTAACAATTCCAAGCAAACACATTCCTGCAG
GTCAGAGAGTGTGTTTGAGAAGACTATAGATTTATGACTTTGGAAATGGTATTGGTTTATTGGTTAAGGA
CGACTGGTTAGTGATTAGAGTTCTCCCAGTTTCTGGATGACAGGATTAGTAACTAAGTATTTTGATCAAC
TTGGATTTTCAAGAGATACAAAATTACTCTTAGTAGCCACACACATTTTCTACAAGTGCTAGCTTTTTAA
GTGTTTTGGTTAAACCCTTCAAACTACAATATTGTTCTCTGTGCAGCTTGATTTCCTAAAGAGACACTGA
TTATGGTAGAGAAAGTCAGACATAATTGAAGAATGGAAGAAAAGCAGGGGGAGCTAGCCTAAGGAAAACA
AGACAGCATCTTTTTTGCTCCTTGATATACATGTTCACTGGAGGAGAACCAAAAAGTCTTTAAAAAT
Notes:The probe template was PCR amplified from IMAGE:875117 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:875117 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000526 same experiment
 EMAGE:30282 same embryo
 EMAGE:30267 same embryo
 EMAGE:30700 same embryo
 EMAGE:31238 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS