Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31086

Cspg4 ( MGI:2153093)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31086 EMAGE:31086 EMAGE:31086 EMAGE:31086 EMAGE:31086
euxassay_009576_01 euxassay_009576_02 euxassay_009576_03 euxassay_009576_04 euxassay_009576_05
EMAGE:31086 EMAGE:31086 EMAGE:31086 EMAGE:31086 EMAGE:31086
euxassay_009576_06 euxassay_009576_07 euxassay_009576_08 euxassay_009576_09 euxassay_009576_10
EMAGE:31086 EMAGE:31086 EMAGE:31086 EMAGE:31086 EMAGE:31086
euxassay_009576_11 euxassay_009576_12 euxassay_009576_13 euxassay_009576_14 euxassay_009576_15
EMAGE:31086 EMAGE:31086 EMAGE:31086 EMAGE:31086 EMAGE:31086
euxassay_009576_16 euxassay_009576_17 euxassay_009576_18 euxassay_009576_19 euxassay_009576_20
EMAGE:31086 EMAGE:31086
euxassay_009576_21 euxassay_009576_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 09
sternum
moderate moderate
regionalmoderate expression: see section 17
forelimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 03 04
forelimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 01 03 04
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 19 20 21
clavicle
strong strong
regionalstrong expression: see section 11 18 moderate expression: see section 12
axial skeleton
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 14 15 16 17
nose
strong strong
regionalstrong expression: see section 10 11 12 13 14 16 17 18 19 20 21 moderate expression: see section 15
otic capsule
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 19
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 19 20 21 22
tibia
moderate moderate
regionalmoderate expression: see section 01 04
femur
moderate moderate
regionalmoderate expression: see section 02 03 04
upper lip
strong strong
regionalstrong expression: see section 17 18 19 moderate expression: see section 16
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 08 09 10 21
lower lip
strong strong
regionalstrong expression: see section 17 18 19 moderate expression: see section 16
cricoid cartilage
strong strong
regionalstrong expression: see section 13 14
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 20 21 22
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 21
laryngeal cartilage
strong strong
regionalstrong expression: see section 15 16
thyroid cartilage
strong strong
regionalstrong expression: see section 13 14 15 16 17
vault of skull
moderate moderate
regionalmoderate expression: see section 02 03 21 22
fibula
moderate moderate
regionalmoderate expression: see section 01 04
trachea cartilaginous ring
strong strong
regionalstrong expression: see section 15 16 17
rib
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 weak expression: see section 01 02 03 04 05 06 07 08 09
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 08 20 21 22
basioccipital bone
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 19 20
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 02 03 14 15 16 17
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36209
Entity Detected:Cspg4, ( MGI:2153093)
Sequence:sense strand is shown

>T36209
AGTACAGAGGGCACCTCACAATGGCTTCCTGAGCCTGGCTGGGGACAACACTGGACCTGTGACTCACTTC
ACACAGGCTGATGTGGATGCAGGGCGACTGGCCTTCGTGGCAAATGGGAGCAGTGTGGCCGGCGTCTTCC
AGTTGAGCATGTCTGATGAAGCCAGCCCCCCCATACCCATGTCCCTGGCTGTGGATGTCTTGCCATCCAC
CATTGAGGTGCAGCTGCGTGCACCCCTGGAGGTGCCCCAAGCTCTAGGACGTACCTCACTGAGCCGGCAA
CAGCTTCAGGTTATTTCCGATCGTGAGGAACCAGATGTAGCTTACCGCCTCACTCAGGGGCCCCTGTATG
GGCAGCTACTAGTAGGGGGGCGGCCTGCCTCCGCCTTCAGCCAGCTGCAGGTAGACCAGGGGGACGTGGT
CTTTGTCTTCACCAACTTCTCTTCCTCTCAGGATCACTTCAAAGTTGTAGCTCTGGCCAGGGGTGTGAAC
GCATCAGCCACCGTAAATGTCACAGTGCAGGCTCTGTTGCATGTGTGGGCTGGTGGGCCATGGCCTCAGG
GTACCACCCTGCGCCTTGACCCCACTGTGCTCGATGCCAGTGAGCTGGCCAACCGCACAGGTAGTATGCC
CCACTTCCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66815. Forward Primer - name:066815_F_cDNA_Cspg4, sequence:AGTACAGAGGGCACCTCACAAT; Reverse Primer - name:066815_N_SP6_cDNA_Cspg4, sequence:CGGAAGTGGGGCATACTACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009576 same experiment
 EMAGE:30913 same embryo
 EMAGE:30912 same embryo
 EMAGE:30911 same embryo
 EMAGE:31143 same embryo
 EMAGE:29359 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS