Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31133

Tnni1 ( MGI:105073)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31133 EMAGE:31133 EMAGE:31133 EMAGE:31133 EMAGE:31133
euxassay_000751_01 euxassay_000751_02 euxassay_000751_03 euxassay_000751_04 euxassay_000751_05
EMAGE:31133 EMAGE:31133 EMAGE:31133 EMAGE:31133 EMAGE:31133
euxassay_000751_06 euxassay_000751_07 euxassay_000751_08 euxassay_000751_09 euxassay_000751_10
EMAGE:31133 EMAGE:31133 EMAGE:31133 EMAGE:31133 EMAGE:31133
euxassay_000751_11 euxassay_000751_12 euxassay_000751_13 euxassay_000751_14 euxassay_000751_15
EMAGE:31133 EMAGE:31133 EMAGE:31133 EMAGE:31133 EMAGE:31133
euxassay_000751_16 euxassay_000751_17 euxassay_000751_18 euxassay_000751_19 euxassay_000751_20
EMAGE:31133 EMAGE:31133 EMAGE:31133 EMAGE:31133
euxassay_000751_21 euxassay_000751_22 euxassay_000751_23 euxassay_000751_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
esophagus
strong strong
regionalstrong expression: see section 13 14 15 17 18 19
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 20 21 22 23 24
heart
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tail
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
limb
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 22 23 24
lower jaw incisor
strong strong
regionalstrong expression: see section 07 09 10 20 21 moderate expression: see section 22 23 weak expression: see section 08
upper jaw incisor
strong strong
regionalstrong expression: see section 07 09 21 moderate expression: see section 22 23 weak expression: see section 08
tongue
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1025
Entity Detected:Tnni1, ( MGI:105073)
Sequence:sense strand is shown

>T1025
TCCTCGAGCCTGTTGGCCTACTGGAAAACTAGGCACTTTGAGCCCTCTTCACCTGTCTCACCTGCACAGG
ACACGAACAGGTGCAGCCTTGCCACCACCATGCCGGAAGTTGAGAGGAAATCCAAGATCACTGCCTCCCG
TAAACTCATGCTGAAGAGCCTGATGCTAGCCAAGGCCAAGGAGTGTTGGGAGCAGGAACACGAGGAGCGA
GAGGCTGAGAAGGTGCGTTACCTCTCGGAGCGCATCCCCACACTGCAGACCCGTGGTCTGTCCCTCAGTG
CCCTTCAGGACTTGTGCCGAGAGCTCCATGCCAAGGTGGAGGTGGTGGATGAGGAGCGCTATGATATTGA
AGCCAAATGCCTCCACAACACCAGAGAGATCAAGGACCTGAAGCTGAAGGTGCTGGACCTCCGTGGGAAG
TTCAAGCGTCCTCCCCTGCGCCGGGTCCGTGTCTCAGCCGATGCCATGCTCCGAGCCCTACTGGGCTCTA
AGCACAAGGTGTCCATGGATCTGCGGGCCAACCTCAAGTCTGTGAAGAAAGAAGACACAGAAAAGGAGC
Notes:The probe template was PCR amplified from IMAGE:2076804 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2076804 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000751 same experiment
 EMAGE:31131 same embryo
 EMAGE:31112 same embryo
 EMAGE:31129 same embryo
 EMAGE:31116 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS