Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31167

Mki67 antigen identified by monoclonal antibody Ki 67 ( MGI:106035)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31167 EMAGE:31167 EMAGE:31167 EMAGE:31167 EMAGE:31167
euxassay_012276_01 euxassay_012276_02 euxassay_012276_03 euxassay_012276_04 euxassay_012276_05
EMAGE:31167 EMAGE:31167 EMAGE:31167 EMAGE:31167 EMAGE:31167
euxassay_012276_06 euxassay_012276_07 euxassay_012276_08 euxassay_012276_09 euxassay_012276_10
EMAGE:31167 EMAGE:31167 EMAGE:31167 EMAGE:31167 EMAGE:31167
euxassay_012276_11 euxassay_012276_12 euxassay_012276_13 euxassay_012276_14 euxassay_012276_15
EMAGE:31167 EMAGE:31167 EMAGE:31167 EMAGE:31167 EMAGE:31167
euxassay_012276_16 euxassay_012276_17 euxassay_012276_18 euxassay_012276_19 euxassay_012276_20
EMAGE:31167 EMAGE:31167
euxassay_012276_21 euxassay_012276_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 06 07 11 12
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 07 15 moderate expression: see section 03 04 05 06 09 11 17 18 19 20 weak expression: see section 08 16
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 07 moderate expression: see section 03 04 05 06 09 11 17 18 19 20 weak expression: see section 08 16
thyroid gland
strong strong
regionalstrong expression: see section 14 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 14 15 16 17
thymus primordium
strong strong
regionalstrong expression: see section 11 14 moderate expression: see section 12 13
vibrissa
strong strong
regionalstrong expression: see section 02 18 moderate expression: see section 03 16 17 weak expression: see section 01
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
hypothalamus ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 11 12
liver
strong strong
regionalstrong expression: see section 01 09 10 11 12 13 14 15 16 17 20 moderate expression: see section 02 03 04 05 06 07 08 18 19 21
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 11 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30431
Entity Detected:Mki67, antigen identified by monoclonal antibody Ki 67 ( MGI:106035)
Sequence:sense strand is shown

>T30431
CCAGGGAAACCAGGAACACACTCAAAGAGCCTGTAGGTGACAGTATAAATGTTGAAGAGGTTAAGAAGTC
TACAAAGCAGAAAATTGATCCAGTAGCAAGTGTGCCTGTCAGCAAGAGGCCACGGAGGGTACCCAAGGAA
AAGGCACAGGCCCTAGAATTGGCTGGTCTCAAAGGACCAATCCAAACCCTAGGCCACACTGATGAATCAG
CAAGTGATAAAGGACCCACACAGATGCCCTGTAATTCTCTACAACCAGAGCAAGTTGACAGCTTCCAAAG
CTCACCAAGGCGACCCAGGACAAGACGTGGGAAAGTAGAGGCAGATGAAGAGCCTTCAGCAGTAAGAAAG
ACAGTATCAACATCAAGGCAAACTATGCGATCCCGCAAGGTCCCTGAAATTGGTAACAATGGTACCCAAG
TTTCAAAGGCCTCCATAAAGCAGACATTAGATACAGTAGCCAAAGTAACTGGCAGCAGGAGGCAGCTAAG
GACACATAAGGATGGGGTTCAACCTCTTGAAGTGTTAGGTGACTCCAAAGAAATAACCCAAATATCAGAT
CACTCTGAGAAACTAGCACATGACACCAGTATCCTTAAGAGCACTCAACAGCAAAAGCCAGACTCAGTAA
AACCTCTGAGAACATGCAGAAGAGTGCTGAGGGCCTCTAAAGAGGACCCCAAGGAAGTGTTGGTGGACAC
CAGAGACCATGCAACATTACAAAGCAAAAGCAACCCTTTGCTGTCCCCGAAGAGGAAGTCTGCAAGAGAT
GGAAGCATTGTGAGAACCAGGGCTTTGCGCTCTTTAGCACCAAAGCAGGAAGCAACAGATGAGAAGCCTG
TACCTGAGAAAAAAAGGGCTGCTTCCAGCAAGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6511975), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58661. Forward Primer - name:058661_F_IRAV105_b10_Mki67, sequence:CCAGGGAAACCAGGAACA; Reverse Primer - name:058661_R_SP6_IRAV105_b10_Mki67, sequence:CTCTTGCTGGAAGCAGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012276 same experiment
 EMAGE:31095 same embryo
 EMAGE:31165 same embryo
 EMAGE:29388 same embryo
 EMAGE:31189 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS