Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31172

Pja2 ( MGI:2159342)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31172 EMAGE:31172 EMAGE:31172 EMAGE:31172 EMAGE:31172
euxassay_000283_01 euxassay_000283_02 euxassay_000283_03 euxassay_000283_04 euxassay_000283_05
EMAGE:31172 EMAGE:31172 EMAGE:31172 EMAGE:31172 EMAGE:31172
euxassay_000283_06 euxassay_000283_07 euxassay_000283_08 euxassay_000283_09 euxassay_000283_10
EMAGE:31172 EMAGE:31172 EMAGE:31172 EMAGE:31172 EMAGE:31172
euxassay_000283_11 euxassay_000283_12 euxassay_000283_13 euxassay_000283_14 euxassay_000283_15
EMAGE:31172 EMAGE:31172 EMAGE:31172 EMAGE:31172 EMAGE:31172
euxassay_000283_16 euxassay_000283_17 euxassay_000283_18 euxassay_000283_19 euxassay_000283_20
EMAGE:31172 EMAGE:31172 EMAGE:31172 EMAGE:31172
euxassay_000283_21 euxassay_000283_22 euxassay_000283_23 euxassay_000283_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
tail dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 09 15
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 12
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3693
Entity Detected:Pja2, ( MGI:2159342)
Sequence:sense strand is shown

>T3693
GCTGAACTTAGGTTTGCAGAACACACTAAACATTTCCAGCTGAGTGTTGAAGCCGTGCATCCCTTTTCTT
CGGTTGACCATGGTGTTGATTGTGACGTCAGCAGTCATCTCTGTGGCACACCTTTCCCTTTTGTCTAAAG
TGCTGCCACTAAGAGATCATCCTTACGCTCCCTTCCCACATGAGATGTGAAGACTGTGGTCACAACAGTA
GTAGTACAACTTGGTTTCATTGAAAATAAACTGAATTCTAAAGCATGCTTTCTCACTGGTCCCTTTGCTT
TTGCTACATCGAAACCTCTTGGTTTATAACAATACTGAGAAGGTTAAGATTGGAGCTTTTCAGAATGCCA
AACAAAGACTAAAGTTTTGACCAGAACACCAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3325560 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3325560 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000283 same experiment
 EMAGE:29827 same embryo
 EMAGE:29435 same embryo
 EMAGE:29856 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS