Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31191

Cbx1 chromobox homolog 1 (Drosophila HP1 beta) ( MGI:105369)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31191 EMAGE:31191 EMAGE:31191 EMAGE:31191 EMAGE:31191
euxassay_012256_01 euxassay_012256_02 euxassay_012256_03 euxassay_012256_04 euxassay_012256_05
EMAGE:31191 EMAGE:31191 EMAGE:31191 EMAGE:31191 EMAGE:31191
euxassay_012256_06 euxassay_012256_07 euxassay_012256_08 euxassay_012256_09 euxassay_012256_10
EMAGE:31191 EMAGE:31191 EMAGE:31191 EMAGE:31191 EMAGE:31191
euxassay_012256_11 euxassay_012256_12 euxassay_012256_13 euxassay_012256_14 euxassay_012256_15
EMAGE:31191 EMAGE:31191 EMAGE:31191 EMAGE:31191 EMAGE:31191
euxassay_012256_16 euxassay_012256_17 euxassay_012256_18 euxassay_012256_19 euxassay_012256_20
EMAGE:31191 EMAGE:31191
euxassay_012256_21 euxassay_012256_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cranial muscle
weak weak
regionalweak expression: see section 01 02 03 04 18 19 20 21 22
neural retina
weak weak
regionalweak expression: see section 01 19 20 21
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 07 08 10 moderate expression: see section 11 weak expression: see section 12
temporal bone petrous part
weak weak
regionalweak expression: see section 03 04 05 20 21 22
pituitary gland
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 09 11 12 13
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 07 08 18 19 20 weak expression: see section 04 05 06 14 15 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 05
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 15 16 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 05
thymus primordium
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 10 11 12 13
renal cortex
strong strong
regionalstrong expression: see section 08 16 17 18 moderate expression: see section 09 15
vibrissa
weak weak
regionalweak expression: see section 03 04 15 16 17
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 14 18 19 20 21 moderate expression: see section 01 02 11 13 15 16 17 weak expression: see section 12
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 14 15 moderate expression: see section 09 16 17 weak expression: see section 12 13
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 13 14
hypothalamus ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 moderate expression: see section 11 weak expression: see section 12
diencephalon lateral wall marginal layer
moderate moderate
homogeneousmoderate expression: see section 11
lower jaw incisor
weak weak
regionalweak expression: see section 08 11 12
upper jaw incisor
weak weak
regionalweak expression: see section 08 10 11 12
lung
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
orbito-sphenoid
weak weak
regionalweak expression: see section 02 03 17 18 19 20
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 weak expression: see section 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30402
Entity Detected:Cbx1, chromobox homolog 1 (Drosophila HP1 beta) ( MGI:105369)
Sequence:sense strand is shown

>T30402
CGGCTCTTTGCTCCTCTGGGCGCGCTACTCCCCTCGGACCGCCCGACGCAACGCGCGAGTAGCGCGGCAC
CGATTCCTCTCGGACTCTCGGGCGCTGCTACGAGCAGTGTCACCCTTCACACCAGAAAGCTGGCGGGTAC
TATGGGGAAAAAGCAAAACAAGAAGAAAGTGGAGGAGGTACTAGAAGAAGAGGAAGAGGAATATGTGGTG
GAAAAAGTTCTTGATCGGCGAGTTGTCAAGGGCAAGGTGGAATATCTTCTAAAGTGGAAGGGTTTCTCAG
ATGAGGACAACACTTGGGAGCCAGAAGAGAATCTGGATTGCCCTGACCTTATTGCTGAGTTTCTACAGTC
ACAGAAAACAGCTCATGAGACAGATAAGTCAGAGGGAGGCAAGCGCAAAGCTGATTCTGATTCTGAAGAT
AAAGGAGAGGAAAGCAAACCAAAGAAGAAGAAAGAAGAGTCAGAAAAGCCACGAGGCTTTGCCCGGGGTT
TGGAGCCAGAGCGGATTATTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6313666), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59230. Forward Primer - name:059230_F_IRAV103_e11_Cbx1, sequence:CGGCTCTTTGCTCCTCTG; Reverse Primer - name:059230_R_SP6_IRAV103_e11_Cbx1, sequence:CCAATAATCCGCTCTGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012256 same experiment
 EMAGE:31473 same embryo
 EMAGE:31169 same embryo
 EMAGE:32005 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS