Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31198

Dpf3 D4, zinc and double PHD fingers, family 3 ( MGI:1917377)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31198 EMAGE:31198 EMAGE:31198 EMAGE:31198 EMAGE:31198
euxassay_003306_01 euxassay_003306_02 euxassay_003306_03 euxassay_003306_04 euxassay_003306_05
EMAGE:31198 EMAGE:31198 EMAGE:31198 EMAGE:31198 EMAGE:31198
euxassay_003306_06 euxassay_003306_07 euxassay_003306_08 euxassay_003306_09 euxassay_003306_10
EMAGE:31198 EMAGE:31198 EMAGE:31198 EMAGE:31198 EMAGE:31198
euxassay_003306_11 euxassay_003306_12 euxassay_003306_13 euxassay_003306_14 euxassay_003306_15
EMAGE:31198 EMAGE:31198 EMAGE:31198 EMAGE:31198 EMAGE:31198
euxassay_003306_16 euxassay_003306_17 euxassay_003306_18 euxassay_003306_19 euxassay_003306_20
EMAGE:31198 EMAGE:31198 EMAGE:31198 EMAGE:31198
euxassay_003306_21 euxassay_003306_22 euxassay_003306_23 euxassay_003306_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
not examined not examined
homogeneousnot examined expression: see section 01 02 03 04 23 24
neural retina
strong strong
regionalstrong expression: see section 02 03 04 23 24 moderate expression: see section 01
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 15 16 18
telencephalon marginal layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon mantle layer
strong strong
regionalstrong expression: see section 04 07 08 10 11 12 13 14 15 16 19 20 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2112
Entity Detected:Dpf3, D4, zinc and double PHD fingers, family 3 ( MGI:1917377)
Sequence:sense strand is shown

>T2112
TGGCCTCGAGCCAGATTCGGCACGAGGGCGACTGTCATTCACAACCCCCTGAAAGCGCTTGGGGACCAGT
TCTACAAGGAAGCCATTGAGCACTGCCGGAGCTACAACTCGAGGCTGTGCGCAGAGCGGAGCGTGCGTCT
CCCCTTCCTGGACTCGCAGACTGGGGTGGCTCAGAACAACTGCTACATCTGGATGGAGAAGAGGCACCGC
GGCCCAGGCCTCGCTCCGGGCCAGTTGTACACATACCCTGCCCGCTGCTGGCGCAAGAAGCGACGATTGC
ACCCACCAGAGGACCCAAAACTACGACTCCTGGAAATCAAACCCGAAGTAGAACTGCCCCTGAAGAAAGA
TGGATTTACCTCTGAGAGTACCACACTGGAAGCCTTGCTTCGCGGCGAGGGAGTAGAGAAGAAGGTGGAT
GCCAGAGAAGAGGAAAGCATCCAGGAGATACAGAGGGTTTTGGAAAATGATGAAAACGTAGAAGAAGGGA
ATGAAGAGGAGGATTTGGAAGAAGATGTTCCCAAGCGCAAGAACAGGACCA
Notes:The probe template was PCR amplified from IMAGE:851370 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:851370 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003306 same experiment
 EMAGE:31150 same embryo
 EMAGE:31152 same embryo
 EMAGE:29396 same embryo
 EMAGE:31466 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS