Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31354

Psd ( MGI:1920978)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31354 EMAGE:31354 EMAGE:31354 EMAGE:31354 EMAGE:31354
euxassay_007524_01 euxassay_007524_02 euxassay_007524_03 euxassay_007524_04 euxassay_007524_05
EMAGE:31354 EMAGE:31354 EMAGE:31354 EMAGE:31354 EMAGE:31354
euxassay_007524_06 euxassay_007524_07 euxassay_007524_08 euxassay_007524_09 euxassay_007524_10
EMAGE:31354 EMAGE:31354 EMAGE:31354 EMAGE:31354 EMAGE:31354
euxassay_007524_11 euxassay_007524_12 euxassay_007524_13 euxassay_007524_14 euxassay_007524_15
EMAGE:31354 EMAGE:31354 EMAGE:31354 EMAGE:31354 EMAGE:31354
euxassay_007524_16 euxassay_007524_17 euxassay_007524_18 euxassay_007524_19 euxassay_007524_20
EMAGE:31354 EMAGE:31354 EMAGE:31354 EMAGE:31354
euxassay_007524_21 euxassay_007524_22 euxassay_007524_23 euxassay_007524_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
weak weak
regionalweak expression: see section 01 02 21 22 23
right lung
weak weak
regionalweak expression: see section 13 14 15 16 17 18 19 20 21 22 23
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 05 06 07 08 17 18 19
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09
tongue
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
spinal cord
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
rectum
strong strong
regionalstrong expression: see section 10 11
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 18
trigeminal v nerve
weak weak
regionalweak expression: see section 08 16
left lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11
midgut
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
bladder
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 13 14 15 16 17 18
esophagus
strong strong
regionalstrong expression: see section 11 12 13 14
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 05 06 18 19 20
vagus x ganglion
weak weak
regionalweak expression: see section 07 08 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 08 09 10 11 13 14 15 16 17
upper lip
weak weak
regionalweak expression: see section 05 06 20
lower lip
weak weak
regionalweak expression: see section 05 06 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35339
Entity Detected:Psd, ( MGI:1920978)
Sequence:sense strand is shown

>T35339
AGTGTAATCCTGAAGCCCTGTCCTCAGAGGACGGTGCTCACACGCTGACCTGTGCCCTCATGCTCCTCAA
CACAGATCTCCATGGCCATAACATTGGGAAGCGCATGACCTGTGGGGACTTCATCGGAAACCTGGAGGGC
CTCAATGATGGTGGCGACTTCCCCAGGGAGCTGCTCAAGGCCTTGTACAGCTCCATCAAGAATGAAAAAT
TGCAATGGGCCATAGACGAGGAGGAGCTGCGACGGTCTCTGTCCGAGTTGGCCGATCCTAACCCCAAGGT
CATCAAGCGGGTCAGCGGAGGCAGTGGCAGCAGTTCCAGCCCCTTCCTGGACCTGACTCCTGAGCCCGGG
GCAGCTGTCTACAAGCACGGGGCCCTGGTGCGAAAGGTGCACGCAGACCCTGACTGCAGGAAGACACCTC
GTGGCAAGCGGGGCTGGAAGAGCTTCCACGGGATCCTCAAGGGCATGATCCTCTACCTGCAGAAGGAGGA
GTATCAGCCTGGGAAGGCTCTTTCCGAGGCAGAGCTGAAGAATGCTATCAGCATCCACCACGCCCTGGCT
ACCCGCGCCAGCGATTATAGCAAGAGACCACACGTCTTCTACCTGCGCACAGCTGACTGGCGGGTCTTCC
TCTTCCAGGCTCCGAGCCTGGAGCAAATGCAGTCCTGGATCACTCGCATCAATGTGGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 101899. Forward Primer - name:101899_F_cDNA_1110007H17Rik, sequence:AGTGTAATCCTGAAGCCCTGTC; Reverse Primer - name:101899_N_SP6_cDNA_1110007H17Rik, sequence:CACCACATTGATGCGAGTGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007524 same experiment
 EMAGE:30317 same embryo
 EMAGE:31314 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS