Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31401

AW549877 ( MGI:2146232)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31401 EMAGE:31401 EMAGE:31401 EMAGE:31401 EMAGE:31401
euxassay_002027_01 euxassay_002027_02 euxassay_002027_03 euxassay_002027_04 euxassay_002027_05
EMAGE:31401 EMAGE:31401 EMAGE:31401 EMAGE:31401 EMAGE:31401
euxassay_002027_06 euxassay_002027_07 euxassay_002027_08 euxassay_002027_09 euxassay_002027_10
EMAGE:31401 EMAGE:31401 EMAGE:31401 EMAGE:31401 EMAGE:31401
euxassay_002027_11 euxassay_002027_12 euxassay_002027_13 euxassay_002027_14 euxassay_002027_15
EMAGE:31401 EMAGE:31401 EMAGE:31401 EMAGE:31401 EMAGE:31401
euxassay_002027_16 euxassay_002027_17 euxassay_002027_18 euxassay_002027_19 euxassay_002027_20
EMAGE:31401 EMAGE:31401 EMAGE:31401 EMAGE:31401
euxassay_002027_21 euxassay_002027_22 euxassay_002027_23 euxassay_002027_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 12 13 14 15 16
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 17 18 19 20 weak expression: see section 21
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 15
spinal cord
weak weak
homogeneousweak expression: see section 08 09 10 11 12 13
brain
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T666
Entity Detected:AW549877, ( MGI:2146232)
Sequence:sense strand is shown

>T666
CCTCGAGNCTGTTGGCCTACTGGCTCTTCGTGGTGTTTCTGATGCCTACAGCCTAAAGGTCTTGGGTTCT
TTATTCACTTGAGGTGGTTTTCTGTCCACCGCCCAGTTCCCTTTTCTATCTTCTATACGGTTATTACATC
TTTCCACAGAAACCAAAACTCTGTACTGTCTTTAGTATTACTTCCCTATTATTTTAAACACAGTATGAAG
TAGCATTGTATGGAAACATTACAGTAAGAGGTACTTAATATAGACACAGCGTATGTATTATATCATGCTG
GTGTTTGGTAGCTTTTGCTTTCCTGCGTCTAGTGAAAATTTATCTTCGGTTTGAATTCTCTGCTGTTGAT
TAAATGTAAAATGTTACAGGATTTTCCCACAATCCTTAAACGTTTATCACTCTTTACTCAGTGTGAGTTT
TCTGATGTGGAGTAGACTTTAAGACTTGATTTAAGAGCCTGTCTCTCTTGCTATGTTTATAGGCTGTCTG
GCTGCTGTGCATTATTTCATGTTAAGTCACATATCATGACATCCCCTTATCCTTTGCTTAC
Notes:The probe template was PCR amplified from IMAGE:1888204 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1888204 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002027 same experiment
 EMAGE:31571 same embryo
 EMAGE:30419 same embryo
 EMAGE:31566 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS