Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31419

AI429152 ( MGI:2138939)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31419 EMAGE:31419 EMAGE:31419 EMAGE:31419 EMAGE:31419
euxassay_000086_01 euxassay_000086_02 euxassay_000086_03 euxassay_000086_04 euxassay_000086_05
EMAGE:31419 EMAGE:31419 EMAGE:31419 EMAGE:31419 EMAGE:31419
euxassay_000086_06 euxassay_000086_07 euxassay_000086_08 euxassay_000086_09 euxassay_000086_10
EMAGE:31419 EMAGE:31419 EMAGE:31419 EMAGE:31419 EMAGE:31419
euxassay_000086_11 euxassay_000086_12 euxassay_000086_13 euxassay_000086_14 euxassay_000086_15
EMAGE:31419 EMAGE:31419 EMAGE:31419 EMAGE:31419 EMAGE:31419
euxassay_000086_16 euxassay_000086_17 euxassay_000086_18 euxassay_000086_19 euxassay_000086_20
EMAGE:31419
euxassay_000086_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
masseter
moderate moderate
regionalmoderate expression: see section 01
trapezius
moderate moderate
regionalmoderate expression: see section 01
pelvic girdle musculature
strong strong
regionalstrong expression: see section 19
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 09 weak expression: see section 05 17 not examined expression: see section 01 02
clavicle
moderate moderate
homogeneousmoderate expression: see section 10
nose
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 15
testis
moderate moderate
regionalmoderate expression: see section 07
ethmoid bone primordium
strong strong
regionalstrong expression: see section 04 moderate expression: see section 03
axial muscle
strong strong
regionalstrong expression: see section 06
pancreas
moderate moderate
regionalmoderate expression: see section 08
vertebral axis musculature
strong strong
regionalstrong expression: see section 19
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14
vibrissa
strong strong
spottedstrong expression: see section 05 moderate expression: see section 04 weak expression: see section 16 17
pectoral girdle and thoracic body wall muscle
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 01 02 03
pectoral girdle and thoracic body wall musculature
strong strong
regionalstrong expression: see section 19 20 21
cranial musculature
strong strong
regionalstrong expression: see section 19 20 21
cranial muscle
strong strong
regionalstrong expression: see section 06 moderate expression: see section 02 03 07
frontal bone primordium
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 02 03 17
deltoid
moderate moderate
regionalmoderate expression: see section 01
latissimus dorsi
moderate moderate
regionalmoderate expression: see section 01
dorsal root ganglion
weak weak
regionalweak expression: see section 10 11 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 15 16 moderate expression: see section 09 17
physiological umbilical hernia
strong strong
regionalstrong expression: see section 05 06 07 moderate expression: see section 08 09 10 weak expression: see section 11
liver
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 09 10 11 12 13 14 15 16 17 19 20 21
lower jaw incisor
strong strong
regionalstrong expression: see section 12 moderate expression: see section 09 13 14
upper jaw incisor
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13
lower jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 14
lung
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 17 weak expression: see section 07 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1587
Entity Detected:AI429152, ( MGI:2138939)
Sequence:sense strand is shown

>T1587
CGTGAGCAGTGAGGCTGTCAGCTTGTTGGAAGAAGTTATTACTCCCCGGAAGGATCTGCCCCCCTTGCTC
CTCAAGTTGAATGAGAGGCCTGCAGAGCGCCTGGATTACCTGGGGGTTTCCTATGGGCTGACCCCCAGGC
TTCTCAAGTTCTGGAAACGAGCTGGATTTGTTCCTGTCTATTTGAGACAGACCCCAAACGACCTGACTGG
GGAACACTCGTGCATTATGCTGAAGACGCTGGCCGATGAGGATGAGGCTGAGCAGGGAGCTTGGCTGGCA
GCATTTTGGAAAGATTTCCGAAGACGGTTCCTGGCCTTGCTGTCATACCAGTTCAGCACCTTCTCTCCTG
CCCTGTCTCTGAACATCATTCAGAACAGGAACGTAGCCAAGTCAGCCCTGCCAGCCCTAGGCCGGGAGCA
TCTGGAGGCACTTTTCCTTCCCTATGACCTGAAGCGTCTAGAGATGTACTCTCGGAACATGGTCGATTAC
CACCTCATCATGGATCTTATCC
Notes:The probe template was PCR amplified from IMAGE:977293 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:977293 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000086 same experiment
 EMAGE:31936 same embryo
 EMAGE:30637 same embryo
 EMAGE:30635 same embryo
 EMAGE:30780 same embryo
 EMAGE:31420 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS