Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31624

Usp53 ( MGI:2139607)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31624 EMAGE:31624 EMAGE:31624 EMAGE:31624 EMAGE:31624
euxassay_014191_01 euxassay_014191_02 euxassay_014191_03 euxassay_014191_04 euxassay_014191_05
EMAGE:31624 EMAGE:31624 EMAGE:31624 EMAGE:31624 EMAGE:31624
euxassay_014191_06 euxassay_014191_07 euxassay_014191_08 euxassay_014191_09 euxassay_014191_10
EMAGE:31624 EMAGE:31624 EMAGE:31624 EMAGE:31624 EMAGE:31624
euxassay_014191_11 euxassay_014191_12 euxassay_014191_13 euxassay_014191_14 euxassay_014191_15
EMAGE:31624 EMAGE:31624 EMAGE:31624 EMAGE:31624 EMAGE:31624
euxassay_014191_16 euxassay_014191_17 euxassay_014191_18 euxassay_014191_19 euxassay_014191_20
EMAGE:31624 EMAGE:31624 EMAGE:31624
euxassay_014191_21 euxassay_014191_22 euxassay_014191_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
lower jaw molar
strong strong
regionalstrong expression: see section 05 06 17
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 15 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 05 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 12 13 14 15
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 12 13 14
upper jaw incisor
strong strong
regionalstrong expression: see section 09 10 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40517
Entity Detected:Usp53, ( MGI:2139607)
Sequence:sense strand is shown

>T40517
AGAGCAGCGATCATGTCAGTAACGGATCTGCCAGCTTGGACTCTCCTGGTGTGGAGGGAAGTGGGGCAGT
CATGGATGTCGGTGGTGGGAAAGCCTTCAGTGAACATATTAAGATGAACAGCCATAATATGGACAGTATG
GAGTATATATCTCATCATTGCAAAGACCACCCAGAAGGCTTTAGGAAAGAACTCCAGGACTTGGAAGCAG
ATGATAAAATTCATGAGCTCCACCCAGAATCACATGTGCAAATAAAAAGCCATTTGATAAAAAGGTCACA
GATTGGTGAAACCAATGACAAGTTGTTTCCTTCAGCCAGCCCACAAACACTTGCAAGAGAGCATGTTTAC
CAGACAAATGAACACAAAGTAGAAAGACCAGATAGGAGCAAATGTTCAGAGAGGCATAATACAGAAAACT
CTGAGGGAACAGGCTTGCCATTTCACGTTGATGAGAGTTCTGTGGCTGGGAAGAGAGTCGACAGTAACGA
AACAGTCTCGCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 162877. Forward Primer - name:162877_F_cDNA_mCG21049.3, sequence:AGAGCAGCGATCATGTCAGTAA; Reverse Primer - name:162877_N_SP6_cDNA_mCG21049.3, sequence:TGGCGAGACTGTTTCGTTACT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_014191 same experiment
 EMAGE:29616 same embryo
 EMAGE:29410 same embryo
 EMAGE:29555 same embryo
 EMAGE:31644 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS