Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31779

Dncic1 ( MGI:107743)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31779 EMAGE:31779 EMAGE:31779 EMAGE:31779 EMAGE:31779
euxassay_006183_01 euxassay_006183_02 euxassay_006183_03 euxassay_006183_04 euxassay_006183_05
EMAGE:31779 EMAGE:31779 EMAGE:31779 EMAGE:31779 EMAGE:31779
euxassay_006183_06 euxassay_006183_07 euxassay_006183_08 euxassay_006183_09 euxassay_006183_10
EMAGE:31779 EMAGE:31779 EMAGE:31779 EMAGE:31779 EMAGE:31779
euxassay_006183_11 euxassay_006183_12 euxassay_006183_13 euxassay_006183_14 euxassay_006183_15
EMAGE:31779 EMAGE:31779 EMAGE:31779 EMAGE:31779 EMAGE:31779
euxassay_006183_16 euxassay_006183_17 euxassay_006183_18 euxassay_006183_19 euxassay_006183_20
EMAGE:31779 EMAGE:31779
euxassay_006183_21 euxassay_006183_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
strong strong
spottedstrong expression: see section 06 16 moderate expression: see section 15
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 08 09
diaphragm
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 11 12 13 moderate expression: see section 10 14 15 16 17 weak expression: see section 18 19 20 21
facial vii ganglion
strong strong
spottedstrong expression: see section 03 04 05 18 19
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
vagus x ganglion
strong strong
spottedstrong expression: see section 06 07 15 16
leg muscle
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 18 19 20 21 22
vertebral axis musculature
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
trigeminal v ganglion
strong strong
spottedstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20
arm muscle
strong strong
spottedstrong expression: see section 21 22 moderate expression: see section 01 02 03 04 05 19 20
lower leg rest of mesenchyme
strong strong
spottedstrong expression: see section 05 06 moderate expression: see section 02 04 weak expression: see section 03
hand
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 15 16 17 19 20 weak expression: see section 10 11 12 13 14 18
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 05 06 14 15 16
spinal cord mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 10 11 12 15 16 17
tegmentum
strong strong
regionalstrong expression: see section 09 10 11 12 moderate expression: see section 07 08 13 14 15
ovary
moderate moderate
regionalmoderate expression: see section 05 06 18
glossopharyngeal ix ganglion
strong strong
spottedstrong expression: see section 06 16
tail paraxial mesenchyme
strong strong
spottedstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 weak expression: see section 05 17
tongue muscle
strong strong
spottedstrong expression: see section 10 11 12 13 14 15
forearm rest of mesenchyme
moderate moderate
spottedmoderate expression: see section 01
medulla oblongata basal plate marginal layer
moderate moderate
regionalmoderate expression: see section 08
dorsal root ganglion
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15
foot
strong strong
spottedstrong expression: see section 06 21 moderate expression: see section 01 07 weak expression: see section 20
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 moderate expression: see section 06 07 13 14 15 16
renal cortex
moderate moderate
regionalmoderate expression: see section 06 07 08 09 14 15 16 17 18
adrenal gland
moderate moderate
regionalmoderate expression: see section 06 07 08 14 15
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T475
Entity Detected:Dncic1, ( MGI:107743)
Sequence:sense strand is shown

>T475
CTCGAGNCTGTTGGCCTACTGGAGAGAGGAAGTGATCGCTCCGGGAGGAGCGCTAGCCTAGCCGCGCAGC
GTGAGACAGCACATCCTGCTGGCGCGGGCCCGCTGCTCTCCGTCCTCCCGCGCCTCCTCCACGACCTCCA
GTGAGCCTCCGCGTACAGCATTCAGGAAGCAAGCATGTCTGACAAGAGCGACCTAAAGGCCGAGCTGGAG
CGCAAAAAGCAGCGCTTAGCACAGATAAGAGAGGAGAAGAAACGGAAGGAAGAGGAGAGGAAGAAGAAAG
AGGCAGATATGCAGCAAAAGAAAGAGCCCGTTCAAGATGACTCCGATCTGGATCGCAAACGACGGGAGAC
AGAAGCTTTGCTTCAGAGCATTGGCATATCACCGGAGCCCCCTCTAGTCCCAACCCCTATGTCTCCCTCT
TCGAAATCAGTGAGCACTCCCAGTGATGCTGGAAGCCAAGACTCGGGCGATCTGGGGCCATTAACAAGGA
CCCTGCAGTGGGACACAGACCCCTCAGTGCTCCAGCTGCAGTCAGACTCAGAACTTGGGAGACGACTGCA
CAAGCTG
Notes:The probe template was PCR amplified from IMAGE:1480265 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1480265 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006183 same experiment
 EMAGE:29726 same embryo
 EMAGE:29976 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS