Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31791

Kdelr3 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 ( MGI:2145953)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31791 EMAGE:31791 EMAGE:31791 EMAGE:31791 EMAGE:31791
euxassay_006187_01 euxassay_006187_02 euxassay_006187_03 euxassay_006187_04 euxassay_006187_05
EMAGE:31791 EMAGE:31791 EMAGE:31791 EMAGE:31791 EMAGE:31791
euxassay_006187_06 euxassay_006187_07 euxassay_006187_08 euxassay_006187_09 euxassay_006187_10
EMAGE:31791 EMAGE:31791 EMAGE:31791 EMAGE:31791 EMAGE:31791
euxassay_006187_11 euxassay_006187_12 euxassay_006187_13 euxassay_006187_14 euxassay_006187_15
EMAGE:31791 EMAGE:31791 EMAGE:31791 EMAGE:31791 EMAGE:31791
euxassay_006187_16 euxassay_006187_17 euxassay_006187_18 euxassay_006187_19 euxassay_006187_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
mandible
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20
temporal bone petrous part
strong strong
regionalstrong expression: see section 03 04 18 19 20
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07
thyroid cartilage
strong strong
regionalstrong expression: see section 09 10 11 12
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04
clavicle
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 13 14 15 16 17
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 12 13 14 15 16 17 18 19
nose
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 15 16 17 18 19 20
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
otic capsule
strong strong
regionalstrong expression: see section 05 06 07 08 14 15 16
bladder
strong strong
regionalstrong expression: see section 10 11 12 13
esophagus
strong strong
regionalstrong expression: see section 09
upper arm mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 17 18 19 20
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20
naris
strong strong
regionalstrong expression: see section 12 13 15
nasal septum
strong strong
regionalstrong expression: see section 14
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T530
Entity Detected:Kdelr3, KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 ( MGI:2145953)
Sequence:sense strand is shown

>T530
TCCTCGAGNCTGTTGGCCTACTGGACCGGCCTGGGGCACCGCGAGGAGCAGGGACGGGGACGTGGCAGCG
CCCCGCGCAACAGAAAGTTCCCTGGGAAGTTCTGCGCGACACGGCGCGGGAGCGGCGGGCGGGACCATGA
ACGTGTTCCGAATCCTCGGGGACCTGAGCCACCTCCTGGCTATGATCTTGCTCCTGGTGAAGATCTGGAG
GTCCAAGAGCTGCGCCGGCATCTCTGGAAAGAGCCAGATTCTTTTCGCTTTGGTCTTTACCACCAGGTAC
CTGGACCTCTTCTCGAACTTCATCTCCATCTACAACACAGTGATGAAGGTGGTTTTCCTCCTCTGTGCCT
ATGTCACAGTGTACATGATCTATTGGAAGTTCCGGAAAACGTTTGACATTGAAAATGACACATTCCGGCT
GGAGTTCCTCCTGGTCCCCGTGACTGGCCTTTCCTTTCTGGTGAACTACAGTTACACGCCGATGGAGGTC
CTCTGGACCTTCTCCATCTATCTGGAGTCAGTGGCTATCCTGCCACAGCT
Notes:The probe template was PCR amplified from IMAGE:1498430 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1498430 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006187 same experiment
 EMAGE:30915 same embryo
 EMAGE:30805 same embryo
 EMAGE:31810 same embryo
 EMAGE:31776 same embryo
 EMAGE:30874 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS