Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31793

Sdk2 ( MGI:2443847)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31793 EMAGE:31793 EMAGE:31793 EMAGE:31793 EMAGE:31793
euxassay_009454_01 euxassay_009454_02 euxassay_009454_03 euxassay_009454_04 euxassay_009454_05
EMAGE:31793 EMAGE:31793 EMAGE:31793 EMAGE:31793 EMAGE:31793
euxassay_009454_06 euxassay_009454_07 euxassay_009454_08 euxassay_009454_09 euxassay_009454_10
EMAGE:31793 EMAGE:31793 EMAGE:31793 EMAGE:31793 EMAGE:31793
euxassay_009454_11 euxassay_009454_12 euxassay_009454_13 euxassay_009454_14 euxassay_009454_15
EMAGE:31793 EMAGE:31793 EMAGE:31793 EMAGE:31793 EMAGE:31793
euxassay_009454_16 euxassay_009454_17 euxassay_009454_18 euxassay_009454_19 euxassay_009454_20
EMAGE:31793 EMAGE:31793 EMAGE:31793 EMAGE:31793
euxassay_009454_21 euxassay_009454_22 euxassay_009454_23 euxassay_009454_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 14 18 weak expression: see section 12 13
ventral grey horn
weak weak
single cellweak expression: see section 08 09 10 11
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 11 12 18 19
tongue
weak weak
regionalweak expression: see section 11 12 15 17 18
clavicle
weak weak
regionalweak expression: see section 09 15
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 07 moderate expression: see section 04 11 12 weak expression: see section 03 05 06 08 13 15 16 17 18
pons mantle layer
strong strong
regionalstrong expression: see section 07 moderate expression: see section 09 10 11 12 weak expression: see section 05 06 08 13 15
hypothalamus mantle layer
weak weak
regionalweak expression: see section 08 09 10 11 12
medulla oblongata basal plate mantle layer
weak weak
single cellweak expression: see section 06 07 08 09 10 11 12
femur
weak weak
regionalweak expression: see section 09 18
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 13
midbrain ventricular layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 12 13 14 15
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 14 15
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 04 05 09 10 11
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 08 09 10 11 12 14
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 12 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36997
Entity Detected:Sdk2, ( MGI:2443847)
Sequence:sense strand is shown

>T36997
TACCTCAGTGAATGTGTCCTGGGATGCCCCACAGTTCCCCAACGGTCCTCTGGAGGGCTACAGGCTGGTG
TACGAACCCTGCACCCCAGTGGATGGGGTCAGCAAGATTGTGACAGTGGACGTGAAGGGGAACAGCCCAC
TGTGGCTGAAAGTGAAGGATCTGGCCGAGGGCATGACGTATCGTTTCCGAATCAAAGCCAAGACCTTCAC
CTATGGGCCTGAGATTGAAGCCAACATCACTACGGGCCCTGGAGAAGGTGCCCCAGGACCACCGGGAGTA
CCGATCATCGTTCGCTACAGCTCAGCCATTGCCATCCACTGGTCCAGCGGAGATCCTGGCAAAGGGCCCA
TCACGCGCTACGTAATAGAGGCCAGGCCTTCAGATGAGGGGCTCTGGGACATTCTCATCAAGGATATCCC
CAAGGAGGTGACTTCCTACACCTTCAGCATGGACATCCTGAAGCCAGGCGTAAGCTATGACTTCCGGGTC
ATCGCAGTCAACGACTACGGCTTTGGCACTCCCAGCAGCCCCTCCCAGTCTGTGCCAGCCCAGAAAGCCA
GCCCCTTTTATGAGGAATGGTGGTTCTTAGTGGTCATTGCTCTTGTGGGCCTCATCTTCATCCTTCTCCT
GGTCTTCGTACTCATCATCCGAGGTCAGAGCAAGAAGTACTCCAAGAAGACAGATTCAGGAGGGAATACC
AAGTCAGGAGCGCTCGGCCACGGGGAGATGCTAAGCTTGGATGAAAGCAGTTTCCCTGCTCTGGAGCTCA
ACAACCGTCGGCTGTCCGTAAAGAACTCCTTCTGCAGGAAGAACGGCTTGTACACCAGGTCCCCTCCCAG
GCCCAGTCCAGGTAGCCTACATTACTCTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75007. Forward Primer - name:075007_F_cDNA_Sdk2, sequence:TACCTCAGTGAATGTGTCCTGG; Reverse Primer - name:075007_N_SP6_cDNA_Sdk2, sequence:TCAGAGTAATGTAGGCTACCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009454 same experiment
 EMAGE:31902 same embryo
 EMAGE:30426 same embryo
 EMAGE:31900 same embryo
 EMAGE:30569 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS