Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31808

Nefm neurofilament, medium polypeptide ( MGI:97314)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31808 EMAGE:31808 EMAGE:31808 EMAGE:31808 EMAGE:31808
euxassay_009463_01 euxassay_009463_02 euxassay_009463_03 euxassay_009463_04 euxassay_009463_05
EMAGE:31808 EMAGE:31808 EMAGE:31808 EMAGE:31808 EMAGE:31808
euxassay_009463_06 euxassay_009463_07 euxassay_009463_08 euxassay_009463_09 euxassay_009463_10
EMAGE:31808 EMAGE:31808 EMAGE:31808 EMAGE:31808 EMAGE:31808
euxassay_009463_11 euxassay_009463_12 euxassay_009463_13 euxassay_009463_14 euxassay_009463_15
EMAGE:31808 EMAGE:31808 EMAGE:31808 EMAGE:31808 EMAGE:31808
euxassay_009463_16 euxassay_009463_17 euxassay_009463_18 euxassay_009463_19 euxassay_009463_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
strong strong
regionalstrong expression: see section 01 02 03
spinal cord mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 16 17
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 08 12 13
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 14 15 16 17 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 16 17
thoracic ganglion
strong strong
regionalstrong expression: see section 10 11 12
midgut
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 11 12 13 14 weak expression: see section 09 10
pons
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16 17 18
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 13 14 15
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 18 19 20
medulla oblongata basal plate
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
vagus x ganglion
strong strong
regionalstrong expression: see section 07 15
thymus primordium
weak weak
regionalweak expression: see section 09 10 12 13
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20
hindgut
moderate moderate
regionalmoderate expression: see section 15
telencephalon mantle layer
strong strong
regionalstrong expression: see section 05 06 07 15 18 19 20 moderate expression: see section 08 09 11 12 13 14 16 17
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 10 11 15 moderate expression: see section 08 09 12 13 14 16 17
lower lip
strong strong
regionalstrong expression: see section 06 07 17 moderate expression: see section 16 weak expression: see section 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36676
Entity Detected:Nefm, neurofilament, medium polypeptide ( MGI:97314)
Sequence:sense strand is shown

>T36676
AGAGCGCAAAGATTACCTGAAGACAGACATCTCCACGGCGCTGAAGGAGATCCGCTCCCAGCTCGAGTGT
CACTCAGACCAGAACATGCACCAGGCCGAAGAGTGGTTCAAATGCCGCTACGCCAAGCTCACCGAGGCGG
CCGAGCAGAACAAGGAGGCCATTCGCTCTGCCAAGGAAGAGATCGCCGAGTACCGGCGCCAGCTGCAGTC
CAAGAGCATCGAGCTCGAGTCGGTGCGAGGCACTAAGGAGTCCCTGGAACGGCAGCTCAGCGACATCGAG
GAGCGCCACAACCACGACCTCAGCAGCTACCAGGACACCATCCAGCAGTTGGAAAATGAACTTCGGGGAA
CCAAGTGGGAAATGGCTCGTCATTTGCGAGAATACCAGGATCTCCTTAACGTCAAGATGGCCCTGGACAT
CGAGATCGCCGCGTACAGGAAACTCCTAGAGGGGGAAGAGACCAGATTTAGCACATTTTCAGGAAGCATC
ACCGGGCCTCTGTACACACACCGACAGCCCTCAGTCACAATATCCAGTAAGATTCAGAAGACCAAAGTCG
AGGCCCCCAAGCTCAAGGTCCAACACAAATTTGTGGAGGAGATCATCGAAGAAACTAAAGTGGAAGATGA
GAAGTCAGAAATGGAAGAAACCCTCACAGCCATCGCAGAGGAGTTGGCAGCCTCCGCCAAAGAGGAGAAG
GAAGAGGCCGAAGAAAAGGAGGAGGAACCAGAAGCCGAAAAGTCTCCCGTGAAGTCTCCTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98199. Forward Primer - name:098199_F_cDNA_Nef3, sequence:AGAGCGCAAAGATTACCTGAAG; Reverse Primer - name:098199_N_SP6_cDNA_Nef3, sequence:TCAGGAGACTTCACGGGAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009463 same experiment
 EMAGE:31504 same embryo
 EMAGE:30096 same embryo
 EMAGE:30413 same embryo
 EMAGE:32037 same embryo
 EMAGE:30466 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS