Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31851

S100a10 S100 calcium binding protein A10 (calpactin) ( MGI:1339468)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31851 EMAGE:31851 EMAGE:31851 EMAGE:31851 EMAGE:31851
euxassay_012613_01 euxassay_012613_02 euxassay_012613_03 euxassay_012613_04 euxassay_012613_05
EMAGE:31851 EMAGE:31851 EMAGE:31851 EMAGE:31851 EMAGE:31851
euxassay_012613_06 euxassay_012613_07 euxassay_012613_08 euxassay_012613_09 euxassay_012613_10
EMAGE:31851 EMAGE:31851 EMAGE:31851 EMAGE:31851 EMAGE:31851
euxassay_012613_11 euxassay_012613_12 euxassay_012613_13 euxassay_012613_14 euxassay_012613_15
EMAGE:31851 EMAGE:31851 EMAGE:31851 EMAGE:31851 EMAGE:31851
euxassay_012613_16 euxassay_012613_17 euxassay_012613_18 euxassay_012613_19 euxassay_012613_20
EMAGE:31851 EMAGE:31851
euxassay_012613_21 euxassay_012613_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
midbrain meninges
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 17
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 14 15 16 17 18
telencephalon meninges
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
trigeminal v nerve
strong strong
regionalstrong expression: see section 10 15
nose
weak weak
regionalweak expression: see section 08 09 10 14 15 16 17
bladder
moderate moderate
regionalmoderate expression: see section 12 13
esophagus
moderate moderate
regionalmoderate expression: see section 13
diaphragm
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 19 20
lower jaw molar
weak weak
regionalweak expression: see section 08 09 17
vagus x ganglion
strong strong
regionalstrong expression: see section 09
upper jaw molar
weak weak
regionalweak expression: see section 08 17
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 14 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 15 16 17 18 19 20 21
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 18 19
upper lip
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19 weak expression: see section 07 09 10 11 12 13 14 20
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 07 08 09 11 13 14 15 16 17 18 19 20 21 weak expression: see section 04 06 10
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
lower lip
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19 weak expression: see section 07 08 09 10 11 12 13 14
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 21 22
mandible
moderate moderate
regionalmoderate expression: see section 04 05 weak expression: see section 06 07
ventral grey horn
strong strong
regionalstrong expression: see section 11 12 13 14 15
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06
palatal shelf
weak weak
regionalweak expression: see section 12 13
diencephalon meninges
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 17 18
pons mantle layer
strong strong
regionalstrong expression: see section 08 09 15 16 17
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 12 13 14 15 16 17 18 19 20 21 22
hindbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
dorsal root ganglion
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 moderate expression: see section 09 10
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 10 11 14 15 16
submandibular gland primordium
weak weak
regionalweak expression: see section 08 09 10 15 16 17 18
lower jaw incisor
weak weak
regionalweak expression: see section 14
upper jaw incisor
weak weak
regionalweak expression: see section 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31596
Entity Detected:S100a10, S100 calcium binding protein A10 (calpactin) ( MGI:1339468)
Sequence:sense strand is shown

>T31596
CCATCCCAAATGGAGCACGCCATGGAAACCATGATGCTTACGTTTCACAGGTTTGCAGGCGACAAAGACC
ACTTGACAAAGGAGGACCTGAGAGTGCTCATGGAACGGGAGTTCCCTGGGTTTTTGGAAAATCAAAAGGA
TCCTCTGGCTGTGGACAAAATAATGAAGGACCTGGACCAGTGCCGAGATGGCAAAGTGGGCTTCCAGAGC
TTTCTATCACTAGTGGCGGGGCTCACCATTGCATGCAATGACTATTTTGTAGTAAACATGAAGCAGAAGG
GGAAGAAATAGGCCAACTGGAGCACTGGTACCCCCACCCTGGTGCGTGTTCACCCACGGGGTCACTTGAG
GAATCTGCCCCACTGCTTCTTGTGAGCAGATCAGGACCCTTAGGAAATGTGCAAATGAGATCCAACTCCA
ATTCAACAATCTGAGAGAGAAAACTTAATCCAATGGCAGAGAAGCTTCTGAGTTTTATATTGTTTGCATC
CCATTGCCCTCAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4949465), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 28724. Forward Primer - name:028724_F_IRAV77-80_C05_S100a10, sequence:CCATCCCAAATGGAGCAC; Reverse Primer - name:028724_R_SP6_IRAV77-80_C05_S100a10, sequence:ATTGAGGGCAATGGGAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012613 same experiment
 EMAGE:31989 same embryo
 EMAGE:29195 same embryo
 EMAGE:29175 same embryo
 EMAGE:29365 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS