Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31860

Pvrl3 ( MGI:1930171)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31860 EMAGE:31860 EMAGE:31860 EMAGE:31860 EMAGE:31860
euxassay_009432_01 euxassay_009432_02 euxassay_009432_03 euxassay_009432_04 euxassay_009432_05
EMAGE:31860 EMAGE:31860 EMAGE:31860 EMAGE:31860 EMAGE:31860
euxassay_009432_06 euxassay_009432_07 euxassay_009432_08 euxassay_009432_09 euxassay_009432_10
EMAGE:31860 EMAGE:31860 EMAGE:31860 EMAGE:31860 EMAGE:31860
euxassay_009432_11 euxassay_009432_12 euxassay_009432_13 euxassay_009432_14 euxassay_009432_15
EMAGE:31860 EMAGE:31860 EMAGE:31860 EMAGE:31860 EMAGE:31860
euxassay_009432_16 euxassay_009432_17 euxassay_009432_18 euxassay_009432_19 euxassay_009432_20
EMAGE:31860 EMAGE:31860 EMAGE:31860 EMAGE:31860
euxassay_009432_21 euxassay_009432_22 euxassay_009432_23 euxassay_009432_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 16 17 18 19 20 21 22 23 24
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 09 10 19 20 21 weak expression: see section 07 08 22 23 24
tail mesenchyme
weak weak
regionalweak expression: see section 13 14 15 16 17 18 19 20
vibrissa
moderate moderate
regionalmoderate expression: see section 23 weak expression: see section 22
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 17 moderate expression: see section 13 weak expression: see section 12 16 18 19 20
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 17 18
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 13 15 16 17 18 moderate expression: see section 09 10 11 12 19 weak expression: see section 07 08 20 21 22 23
diencephalon roof plate
strong strong
regionalstrong expression: see section 16 weak expression: see section 14
tongue muscle
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 weak expression: see section 12 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36847
Entity Detected:Pvrl3, ( MGI:1930171)
Sequence:sense strand is shown

>T36847
GGCAACACTTAAGGATGACACAATTGGCACCATCATTGCTAGTGTAGTGGGTGGGGCTCTCTTCTTAGTG
CTTGTGAGCATTTTAGCTGGGGTATTCTGCTATAGGAGACGACGGACGTTTCGTGGAGACTACTTTGCCA
AAAACTACATTCCACCATCAGACATGCAGAAAGAATCACAGATTGATGTTCTTCACCAGGATGAGCTGGA
TTCTTACCCAGACAGTGTAAAAAAGGAAAACAAAAATCCAGTAAACAACCTGATCCGCAAAGACTACTTA
GAGGAGCCTGAGAAAACTCAGTGGAATAATGTAGAGAACCTCACTAGGTTTGAAAGACCGATGGATTACT
ATGAAGATCTAAAAATGGGAATGAAGTTTGTCAGTGATGAACGCTACAATGAAAGTGAAGATGGTTTGGT
TTCTCATGTAGATGGCTCCGTAATTTCCAGGAGGGAGTGGTATGTCTAACAGCCACTGACGCGACTTCAC
TATGTACAAGGTTTCATTCACACTAGTTGACC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90951. Forward Primer - name:090951_F_cDNA_Pvrl3, sequence:GGCAACACTTAAGGATGACACA; Reverse Primer - name:090951_N_SP6_cDNA_Pvrl3, sequence:GGTCAACTAGTGTGAATGAAAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009432 same experiment
 EMAGE:31861 same embryo
 EMAGE:29434 same embryo
 EMAGE:30568 same embryo
 EMAGE:29415 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS