Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32039

Mmp24 ( MGI:1341867)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32039 EMAGE:32039 EMAGE:32039 EMAGE:32039 EMAGE:32039
euxassay_009394_01 euxassay_009394_02 euxassay_009394_03 euxassay_009394_04 euxassay_009394_05
EMAGE:32039 EMAGE:32039 EMAGE:32039 EMAGE:32039 EMAGE:32039
euxassay_009394_06 euxassay_009394_07 euxassay_009394_08 euxassay_009394_09 euxassay_009394_10
EMAGE:32039 EMAGE:32039 EMAGE:32039 EMAGE:32039 EMAGE:32039
euxassay_009394_11 euxassay_009394_12 euxassay_009394_13 euxassay_009394_14 euxassay_009394_15
EMAGE:32039 EMAGE:32039 EMAGE:32039 EMAGE:32039
euxassay_009394_16 euxassay_009394_17 euxassay_009394_18 euxassay_009394_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
weak weak
regionalweak expression: see section 03
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 14
spinal cord
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
brain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 weak expression: see section 01 02
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 15
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08
thoracic ganglion
weak weak
regionalweak expression: see section 11 12
retina
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 01 02
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 14 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 16
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 05 06 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 15 16 17
cervical ganglion
weak weak
regionalweak expression: see section 07 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36634
Entity Detected:Mmp24, ( MGI:1341867)
Sequence:sense strand is shown

>T36634
GACCTTTGAAGAGGTGCCATACCATGAGATCAAAAGTGACCGGAAGGAGGCAGACATCATGATCTTCTTT
GCTTCTGGTTTCCATGGTGACAGCTCCCCATTTGATGGGGAAGGGGGATTCCTAGCCCATGCCTACTTTC
CTGGCCCAGGGATCGGAGGAGACACTCACTTTGATTCAGATGAACCCTGGACGCTAGGAAATGCCAACCA
TGATGGCAATGACCTCTTCCTGGTGGCCGTGCATGAACTGGGCCATGCACTGGGCTTGGAGCACTCTAAT
GACCCCAGTGCTATCATGGCTCCCTTCTACCAATACATGGAGACACACAACTTCAAGCTACCGCAGGACG
ATCTCCAGGGCATCCAGAAGATTTACGGACCCCCAGCTGAGCCCTCTGGAGCCACAAGGCCCCTCCCTAC
ACTCCCGGTCCGCAGGATCCACTCGCCCTCTGAGAAGAAGCACGAGCGGCACCCAAGGCCCCCACGGCGC
CCTTGGGGACGGCCATCCACTCCAGGTGCCAAACCCAACATCTGCGATGGCAACTTCAACACAGTGGCCC
TCTTCCGAGGGGAGATGTTTGTGTTCAAGGATCGCTGGTTCTGGCGCCTGCGCAATAACCGGGTGCAGGA
AGGCTACCCCATGCAGATCGAACAGTTCTGGAAGGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99229. Forward Primer - name:099229_F_cDNA_Mmp24, sequence:GACCTTTGAAGAGGTGCCATAC; Reverse Primer - name:099229_N_SP6_cDNA_Mmp24, sequence:GCCCTTCCAGAACTGTTCGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009394 same experiment
 EMAGE:31099 same embryo
 EMAGE:31098 same embryo
 EMAGE:30154 same embryo
 EMAGE:29953 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS