Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32069

Zswim6 ( MGI:1914513)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32069 EMAGE:32069 EMAGE:32069 EMAGE:32069 EMAGE:32069
euxassay_012565_01 euxassay_012565_02 euxassay_012565_03 euxassay_012565_04 euxassay_012565_05
EMAGE:32069 EMAGE:32069 EMAGE:32069 EMAGE:32069 EMAGE:32069
euxassay_012565_06 euxassay_012565_07 euxassay_012565_08 euxassay_012565_09 euxassay_012565_10
EMAGE:32069 EMAGE:32069 EMAGE:32069 EMAGE:32069 EMAGE:32069
euxassay_012565_11 euxassay_012565_12 euxassay_012565_13 euxassay_012565_14 euxassay_012565_15
EMAGE:32069 EMAGE:32069 EMAGE:32069 EMAGE:32069 EMAGE:32069
euxassay_012565_16 euxassay_012565_17 euxassay_012565_18 euxassay_012565_19 euxassay_012565_20
EMAGE:32069 EMAGE:32069 EMAGE:32069 EMAGE:32069
euxassay_012565_21 euxassay_012565_22 euxassay_012565_23 euxassay_012565_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
maxilla
weak weak
regionalweak expression: see section 07 08 09 17 18 19 20
mandible
weak weak
regionalweak expression: see section 04 05 07 08 09 17 18 19 20 21 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 18 19 20 21
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 15 16 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31415
Entity Detected:Zswim6, ( MGI:1914513)
Sequence:sense strand is shown

>T31415
CAGCACCATAGTCCGCCTCCACCTGGACTGCCATCAACAGGAAAAGCTGGCCAGCAGTGCCCGGACGCTG
GCATTGCAGTGCGCCATGAAGGACCCGCAGAACTGCGCCCTCTCTGCACTGACCCTCTGTGAAAAGGACC
ACATAGCTTTTGAGACGGCGTACCAAATCGTCCTTGATGCTGCTACCACCGGCATGAGCTACACACAGCT
CTTTACAATAGCACGGTACATGGAGCACCGTGGGTACCCGATGAGGGCCTACAAGCTGGCCACGCTGGCC
ATGACCCATCTCAACCTGAGCTACAATCAGGACACACACCCTGCCATTAATGACGTTCTGTGGGCCTGTG
CGCTTAGTCACTCCCTCGGTAAGAATGAGCTAGCAGCTATAATACCTCTGGTGGTTAAGAGCGTCAAATG
CGCAACGGTACTGTCGGACATTTTGCGCAGGTGCACCCTGACCACCCCGGGCATGGTGGGACTTCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5025391), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 24677. Forward Primer - name:024677_F_IRAV55-58_P23_Zswim6, sequence:CAGCACCATAGTCCGCCT; Reverse Primer - name:024677_R_SP6_IRAV55-58_P23_Zswim6, sequence:ATGAAGTCCCACCATGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012565 same experiment
 EMAGE:32064 same embryo
 EMAGE:30989 same embryo
 EMAGE:30092 same embryo
 EMAGE:30073 same embryo
 EMAGE:30693 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS