Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32075

Sp6 trans-acting transcription factor 6 ( MGI:1932575)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32075 EMAGE:32075 EMAGE:32075 EMAGE:32075 EMAGE:32075
euxassay_000590_01 euxassay_000590_02 euxassay_000590_03 euxassay_000590_04 euxassay_000590_05
EMAGE:32075 EMAGE:32075 EMAGE:32075 EMAGE:32075 EMAGE:32075
euxassay_000590_06 euxassay_000590_07 euxassay_000590_08 euxassay_000590_09 euxassay_000590_10
EMAGE:32075 EMAGE:32075 EMAGE:32075 EMAGE:32075 EMAGE:32075
euxassay_000590_11 euxassay_000590_12 euxassay_000590_13 euxassay_000590_14 euxassay_000590_15
EMAGE:32075 EMAGE:32075 EMAGE:32075 EMAGE:32075 EMAGE:32075
euxassay_000590_16 euxassay_000590_17 euxassay_000590_18 euxassay_000590_19 euxassay_000590_20
EMAGE:32075 EMAGE:32075 EMAGE:32075 EMAGE:32075
euxassay_000590_21 euxassay_000590_22 euxassay_000590_23 euxassay_000590_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 03 04 15 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 03 04 15 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T11
Entity Detected:Sp6, trans-acting transcription factor 6 ( MGI:1932575)
Sequence:sense strand is shown

>T11
CCAGACCGTGTGTCGCTGCCCCAACTGCCTGGAGGCGGAGCGACTCGGGGCTCCGTGCGGGCCCGATGGG
GGCAAGAAGAAGCATTTGCACAACTGCCACATCCCAGGCTGCGGCAAGGCATACGCTAAGACGTCGCATC
TGAAGGCGCACCTGCGGTGGCACAGCGGTGACCGACCCTTCGTGTGCAACTGGCTTTTCTGCGGCAAGCG
CTTCACGCGCTCCGACGAGCTGCAGCGCCACCTTCAGACCCACACCGGGACCAAGAAGTTCCCCTGTGCG
GTCTGCAGCCGAGTCTTCATGCGCAGCGACCACCTGGCCAAACACATGAAAACCCACGAAGGCGCCAAAG
AGGAGGCGGCGGCGGCGGCCCAAGGCGAGGGCAAGGCCGGTGGCGTGGTGGAACCACCCGGGGGCAAAGG
CAAACGTGAGGCCGAAGGCAGCTCGGCGTCCTCCAACTGAGCCCCATGGATGTCACATACCTGCCGTTCT
TTATTTGGGGGGGCG
Notes:The probe template was PCR amplified from IMAGE:793227 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:793227 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000590 same experiment
 EMAGE:30171 same embryo
 EMAGE:30188 same embryo
 EMAGE:30205 same embryo
 EMAGE:30677 same embryo
 EMAGE:30422 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS