Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32082

Esx1 extraembryonic, spermatogenesis, homeobox 1 ( MGI:1096388)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32082 EMAGE:32082 EMAGE:32082 EMAGE:32082 EMAGE:32082
euxassay_016592_01 euxassay_016592_02 euxassay_016592_03 euxassay_016592_04 euxassay_016592_05
EMAGE:32082 EMAGE:32082 EMAGE:32082 EMAGE:32082 EMAGE:32082
euxassay_016592_06 euxassay_016592_07 euxassay_016592_08 euxassay_016592_09 euxassay_016592_10
EMAGE:32082 EMAGE:32082 EMAGE:32082 EMAGE:32082 EMAGE:32082
euxassay_016592_11 euxassay_016592_12 euxassay_016592_13 euxassay_016592_14 euxassay_016592_15
EMAGE:32082 EMAGE:32082 EMAGE:32082 EMAGE:32082 EMAGE:32082
euxassay_016592_16 euxassay_016592_17 euxassay_016592_18 euxassay_016592_19 euxassay_016592_20
EMAGE:32082 EMAGE:32082 EMAGE:32082 EMAGE:32082
euxassay_016592_21 euxassay_016592_22 euxassay_016592_23 euxassay_016592_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cranial muscle
moderate moderate
regionalmoderate expression: see section 03 21 22 23 weak expression: see section 01 02 20 24
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 01
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 03
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
viscerocranium
moderate moderate
regionalmoderate expression: see section 06 07 16 17 18 19 20
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 14 15 16 17 18 19
dorsal root ganglion
weak weak
single cellweak expression: see section 06 07 08 09 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 04 05 weak expression: see section 19 20
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 weak expression: see section 07 08 16 17 18 19 20 21
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 03
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 03 04 18 19 20 weak expression: see section 02 05
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45066
Entity Detected:Esx1, extraembryonic, spermatogenesis, homeobox 1 ( MGI:1096388)
Sequence:sense strand is shown

>T45066
GTTTGGTTTCAGAACAGAAGGGCCAAGTGGAGACGACTTCGGCGGGCACAGGCATTCAGAAACATGGTTC
CAGTCGCCATGAGTCCCCCTGTGGGTGTCTATCTTGATGATCATTATGGCCCCATCCCTATTGTGGAGGT
TATTTGGAAGTGCTACCCAATGGTGCCTCGTCCCATGCATCCTCAAATGATGCCTCTTCCACCCAGGCCC
CCTCCAGGATTCAGAATGCCTCCACCATTTAGGCCACCTCCTCTGCCACCTTTTCCCTGGCCACCTGTAC
CACCTGATGCGCACATACCCAATGCAGCAAGGGAATATAACCCCTTCCCCTTCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 166618166618. Forward Primer - name:166618_F_Esx1, sequence:GTTTGGTTTCAGAACAGAAGGG; Reverse Primer - name:166618_R_SP6_Esx1, sequence:GGGAAGGGGAAGGGGTTATATT.The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016592 same experiment
 EMAGE:32086 same embryo
 EMAGE:32087 same embryo
 EMAGE:32089 same embryo
 EMAGE:32083 same embryo
 EMAGE:32090 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS