Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32128

Agtpbp1 ( MGI:2159437)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32128 EMAGE:32128 EMAGE:32128 EMAGE:32128 EMAGE:32128
euxassay_007611_01 euxassay_007611_02 euxassay_007611_03 euxassay_007611_04 euxassay_007611_05
EMAGE:32128 EMAGE:32128 EMAGE:32128 EMAGE:32128 EMAGE:32128
euxassay_007611_06 euxassay_007611_07 euxassay_007611_08 euxassay_007611_09 euxassay_007611_10
EMAGE:32128 EMAGE:32128 EMAGE:32128 EMAGE:32128 EMAGE:32128
euxassay_007611_11 euxassay_007611_12 euxassay_007611_13 euxassay_007611_14 euxassay_007611_15
EMAGE:32128 EMAGE:32128 EMAGE:32128 EMAGE:32128 EMAGE:32128
euxassay_007611_16 euxassay_007611_17 euxassay_007611_18 euxassay_007611_19 euxassay_007611_20
EMAGE:32128 EMAGE:32128 EMAGE:32128 EMAGE:32128
euxassay_007611_21 euxassay_007611_22 euxassay_007611_23 euxassay_007611_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 15 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 15 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21 22
ventral grey horn
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35894
Entity Detected:Agtpbp1, ( MGI:2159437)
Sequence:sense strand is shown

>T35894
ACGTGTTGTGTGAAACCTTGTCTGGAAACATCTGTCCTTTGGTGACCATAACAGCAATGCCAGAGTCCAA
TTACTATGAACATATCTGTCAGTTCAGAACTCGCCCTTATATTTTCTTGTCTGCTCGGGTCCATCCTGGA
GAAACCAATGCAAGCTGGGTAATGAAAGGAACACTGGAGTACCTCATGAGCAATAGCCCGACTGCCCAGA
GCCTACGGGAGTCTTACATTTTTAAAATTGTCCCCATGCTAAATCCAGATGGTGTCATCAATGGAAATCA
CCGCTGCTCCTTAAGTGGAGAGGGTTTGAACAGACAGTGGCAAAGTCCAAACCCAGAGTTACACCCCACG
ATTTATCATGCCAAGGGGCTGCTGCAGTACCTGGCCGCGGTGAAGCGCCTACCTCTGGTTTATTGTGATT
ACCATGGCCATTCTCGGAAAAAGAATGTATTCATGTACGGCTGCAGCATCAAAGAGACGGTGTGGCACAC
CCATGACAACTCGGCTTCCTGTGATATTGTGGAAGGCATGGGATACAGGACTTTGCCTAAGATACTGAGC
CACATTGCTCCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91191. Forward Primer - name:091191_F_cDNA_Agtpbp1, sequence:ACGTGTTGTGTGAAACCTTGTC; Reverse Primer - name:091191_N_SP6_cDNA_Agtpbp1, sequence:CGGAGCAATGTGGCTCAGTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007611 same experiment
 EMAGE:30855 same embryo
 EMAGE:30811 same embryo
 EMAGE:30807 same embryo
 EMAGE:30731 same embryo
 EMAGE:30730 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS